C19orf40-chromosome 19 open reading frame 40 Gene View larger

C19orf40-chromosome 19 open reading frame 40 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf40-chromosome 19 open reading frame 40 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf40-chromosome 19 open reading frame 40 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020247
Product type: DNA & cDNA
Ncbi symbol: C19orf40
Origin species: Human
Product name: C19orf40-chromosome 19 open reading frame 40 Gene
Size: 2ug
Accessions: BC020247
Gene id: 91442
Gene description: chromosome 19 open reading frame 40
Synonyms: C19orf40; Fanconi anemia core complex-associated protein 24; Fanconi anemia-associated protein of 24 kDa; Fanconi anemia core complex associated protein 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaagaacccccctgatgatacgggccccgtgcacgtgcctttggggcatattgtggccaatgagaaatggcgcgggtcacagctggcgcaggagatgcaagggaaaattaagctcattttcgaggatggcttgacaccagacttttatctgtcgaacagatgctgcattctttatgtcaccgaagctgatttggtggcaggaaatggctacagaaagaggcttgttcgggttagaaattccaataatcttaaaggaattgtagtcgttgaaaaaacccggatgagtgaacaatacttcccagccctacagaagtttactgtgctggaccttggaatggtgctgcttccagtggccagccagatggaagcatcctgcctcgtcatccagttggttcaagagcaaaccaaagagcccagtaagaaccctcttctcgggaagaaacgggccctgctgctgtctgagccttcgctccttcgaaccgtgcagcagatcccaggagttggaaaagttaaagctccccttctcctccagaagtttccaagcatccagcaactgagtaatgcttccattggggaactggagcaggtggtcggacaagcagtggcacagcagatccatgccttcttcacgcagcccaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coenzyme Q7 homolog, ubiquinone (yeast)
- chromosome 11 open reading frame 70
- chromosome 6 open reading frame 105
- protein C receptor, endothelial (EPCR)

Buy C19orf40-chromosome 19 open reading frame 40 Gene now

Add to cart