Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of COQ7-coenzyme Q7 homolog, ubiquinone (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COQ7-coenzyme Q7 homolog, ubiquinone (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003185 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COQ7 |
| Origin species: | Human |
| Product name: | COQ7-coenzyme Q7 homolog, ubiquinone (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC003185 |
| Gene id: | 10229 |
| Gene description: | coenzyme Q7 homolog, ubiquinone (yeast) |
| Synonyms: | ubiquinone biosynthesis protein COQ7 homolog; ubiquinone biosynthesis monooxygenase COQ7; COQ7 coenzyme Q, 7 homolog ubiquinone; CAT5; CLK-1; CLK1; COQ10D8; 5-demethoxyubiquinone hydroxylase, mitochondrial; 5-demethoxyubiquinone hydroxylase; DMQ hydroxylase; coenzyme Q biosynthesis protein 7 homolog; coenzyme Q7 homolog, ubiquinone; placental protein KG-20; timing protein clk-1 homolog; coenzyme Q7, hydroxylase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagttgcgccggggcggcggcggctccccgcctttggcggctgcgcccgggggcccggcggtccctctcagcttatggaagaagaaccagtgtcagatttcgcagttcaggaatgactttagacaatatcagtcgggcagctgtggatcgaataatccgggtggatcatgcaggcgaatatggagcaaaccgcatctatgccgggcagatggctgtcctgggtcggaccagcgtcgggccagtcattcagaaaatgtgggatcaagaaaaggaccatttgaaaaagttcaatgagttgatggttacgttcagggtccggccaacagttctgatgcccttgtggaacgtgctggggtttgcactgggggcggggaccgccttgctcgggaaggaaggtgccatggcctgcaccgtggcggtggaagagagcatagcacatcactacaacaaccagatcaggacgctgatggaggaggaccctgaaaaatacgaggaacttcttcagctgataaagaaatttcgggatgaagagcttgagcaccatgacataggcctcgaccatgatgcagaattggctccagcctatgccgtcctgaagagcattatccaggccggatgcagagtggcgatatatttatcagaaagattataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 11 open reading frame 70 - chromosome 6 open reading frame 105 - protein C receptor, endothelial (EPCR) - B-cell receptor-associated protein 29 |