C16orf68-chromosome 16 open reading frame 68 Gene View larger

C16orf68-chromosome 16 open reading frame 68 Gene

PTXBC001908

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf68-chromosome 16 open reading frame 68 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf68-chromosome 16 open reading frame 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001908
Product type: DNA & cDNA
Ncbi symbol: C16orf68
Origin species: Human
Product name: C16orf68-chromosome 16 open reading frame 68 Gene
Size: 2ug
Accessions: BC001908
Gene id: 79091
Gene description: chromosome 16 open reading frame 68
Synonyms: C16orf68; methyltransferase-like protein 22; LP8272; methyltransferase like 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtacagctggctcctgcggcagccatggacgaggtcacctttaggagcgacactgtgctgtcagatgtccacctctataccccgaaccatagacatctcatggtacggctgaacagcgtggggcagccagttttcctgtcccaattcaagcttctatggagccaagactcttggacagattcaggagccaagggtggcagtcacagagatgttcacacaaaggagcctccttctgctgagacaggcagcacagggtcccctccaggaagtggccatggtaatgagggtttctccctccaggccgggactgacaccactggccaggaagtggctgaagctcagctggatgaggatggggatttggacgtggtgagaagaccacgagccgcctctgattccaacccagcagggcctctgagagacaaggtacatcccatgattctagcacaggaagaagacgacgtcctgggagaggaagcacaaggcagcccgcacgatatcatcagaataggtgtggcggggcgccctgctcctggcagactacatcctgttccgacaggacctcttccgaggatgtacagcgctggagctcggggccggcacggggctcgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 40
- coenzyme Q7 homolog, ubiquinone (yeast)
- chromosome 11 open reading frame 70
- chromosome 6 open reading frame 105

Buy C16orf68-chromosome 16 open reading frame 68 Gene now

Add to cart