Login to display prices
Login to display prices
USP53-ubiquitin specific peptidase 53 Gene View larger

USP53-ubiquitin specific peptidase 53 Gene

PTXBC017382

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP53-ubiquitin specific peptidase 53 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about USP53-ubiquitin specific peptidase 53 Gene

Proteogenix catalog: PTXBC017382
Ncbi symbol: USP53
Product name: USP53-ubiquitin specific peptidase 53 Gene
Size: 2ug
Accessions: BC017382
Gene id: 54532
Gene description: ubiquitin specific peptidase 53
Synonyms: inactive ubiquitin carboxyl-terminal hydrolase 53; inactive ubiquitin-specific peptidase 53; ubiquitin specific protease 53; ubiquitin specific proteinase 53; ubiquitin specific peptidase 53
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcaatgttactttgagaactctctatccacagaatgtataattcggtcagccagcagatctgatgggtgtcagatgccaaaacttttttgccagaatctaccaccccctttgccaccaaagaaatatgctataaccagtgtgccacagtcagagaaaagcgaatctacacctgatgtcaaacttacagaggtgtttaaagctacctctcatcttccgaagcacagtttaagtacagcttcagaaccaagtttagaagtgagtacacatatgaatgatgaaagacataaagaaacatttcaagtgagagaatgttttggcaacacaccaaactgtccatccagctcctcaactaacgattttcaggcaaactcaggtgccattgatgcattttgccaaccagaactagactctatttctacctgtccaaatgagacagtttcattaactacctatttttcagttgatagctgcatgacggatacatatagattgaaataccatcagaggcccaagctctcttttccagagagcagtggcttttgtaataattcactatcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: