Login to display prices
Login to display prices
N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene View larger

N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene

PTXBC011554

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene

Proteogenix catalog: PTXBC011554
Ncbi symbol: N6AMT1
Product name: N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene
Size: 2ug
Accessions: BC011554
Gene id: 29104
Gene description: N-6 adenine-specific DNA methyltransferase 1 (putative)
Synonyms: C21orf127; HEMK2; MTQ2; N6AMT; PRED28; m.HsaHemK2P; hemK methyltransferase family member 2; N6-DNA-methyltransferase; n(6)-adenine-specific DNA methyltransferase 1; N-6 adenine-specific DNA methyltransferase 1 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggggagaacttcgctacgccgttccacgggcacgtgggccgcggcgccttcagcgacgtgtacgagcccgcggaggacacgtttctgcttttggacgcgctcgaggcagcggctgccgaactggcaggagtggaaatatgcctggaagtagggtcagggtctggtgtagtatctgcattcctagcctctatgataggccctcaggctttgtacatgtgcactgatatcaaccctgaggcagcagcttgtaccctagagacagcacgctgtaacaaagttcacattcaaccagttattacagatttggtaggaagtcacggaatagaggcagcttgggctggtggcagaaatggtcgggaagtcatggacaggttttttcccctggttccagatctcctttcaccaagaggattattctatttagttaccattaaagaaaacaacccagaagaaattttgaaaataatgaagacaaaaggtctgcaaggaaccactgcactttccagacaagcaggccaagaaactctttcagtcctcaagttcaccaagtcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: