N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene View larger

N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011554
Product type: DNA & cDNA
Ncbi symbol: N6AMT1
Origin species: Human
Product name: N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene
Size: 2ug
Accessions: BC011554
Gene id: 29104
Gene description: N-6 adenine-specific DNA methyltransferase 1 (putative)
Synonyms: C21orf127; HEMK2; MTQ2; N6AMT; PRED28; m.HsaHemK2P; hemK methyltransferase family member 2; N6-DNA-methyltransferase; n(6)-adenine-specific DNA methyltransferase 1; N-6 adenine-specific DNA methyltransferase 1 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggggagaacttcgctacgccgttccacgggcacgtgggccgcggcgccttcagcgacgtgtacgagcccgcggaggacacgtttctgcttttggacgcgctcgaggcagcggctgccgaactggcaggagtggaaatatgcctggaagtagggtcagggtctggtgtagtatctgcattcctagcctctatgataggccctcaggctttgtacatgtgcactgatatcaaccctgaggcagcagcttgtaccctagagacagcacgctgtaacaaagttcacattcaaccagttattacagatttggtaggaagtcacggaatagaggcagcttgggctggtggcagaaatggtcgggaagtcatggacaggttttttcccctggttccagatctcctttcaccaagaggattattctatttagttaccattaaagaaaacaacccagaagaaattttgaaaataatgaagacaaaaggtctgcaaggaaccactgcactttccagacaagcaggccaagaaactctttcagtcctcaagttcaccaagtcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1, regulatory (inhibitor) subunit 8
- coiled-coil-helix-coiled-coil-helix domain containing 6
- major histocompatibility complex, class II, DP beta 1
- major histocompatibility complex, class II, DP beta 1

Buy N6AMT1-N-6 adenine-specific DNA methyltransferase 1 (putative) Gene now

Add to cart