Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD99-CD99 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD99-CD99 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002584 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD99 |
| Origin species: | Human |
| Product name: | CD99-CD99 molecule Gene |
| Size: | 2ug |
| Accessions: | BC002584 |
| Gene id: | 4267 |
| Gene description: | CD99 molecule |
| Synonyms: | CD99 molecule; CD99 antigen; HBA71; MIC2; MIC2X; MIC2Y; MSK5X; E2 antigen; MIC2 (monoclonal antibody 12E7); T-cell surface glycoprotein E2; antigen identified by monoclonal 12E7, Y homolog; antigen identified by monoclonal antibodies 12E7, F21 and O13; cell surface antigen 12E7; cell surface antigen HBA-71; cell surface antigen O13; surface antigen MIC2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgcggggctgcgctggcgctgctgctcttcggcctgctgggtgttctggtcgccgccccggatggtggtttcgatttatctgatgcccttcctgacaatgaaaacaagaaacccactgcaatccccaagaaacccagtgctggggatgactttgacttaggagatgctgttgttgatggagaaaatgacgacccacgaccaccgaacccacccaaaccgatgccaaatccaaaccccaaccaccctagttcctccggtagcttttcagatgctgaccttgcggatggcgtttcaggtggagaaggaaaaggaggcagtgatggtggaggcagccacaggaaagaaggggaagaggccgacgccccaggcgtgatccccgggattgtgggggctgtcgtggtcgccgtggctggagccatctctagcttcattgcttaccagaaaaagaagctatgcttcaaagaaaatgcagaacaaggggaggtggacatggagagccaccggaatgccaacgcagagccagctgttcagcgtactcttttagagaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - orosomucoid 2 - BCL2-like 1 - CD81 molecule - CD58 molecule |