CD99-CD99 molecule Gene View larger

CD99-CD99 molecule Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD99-CD99 molecule Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CD99-CD99 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002584
Product type: DNA & cDNA
Ncbi symbol: CD99
Origin species: Human
Product name: CD99-CD99 molecule Gene
Size: 2ug
Accessions: BC002584
Gene id: 4267
Gene description: CD99 molecule
Synonyms: CD99 molecule; CD99 antigen; HBA71; MIC2; MIC2X; MIC2Y; MSK5X; E2 antigen; MIC2 (monoclonal antibody 12E7); T-cell surface glycoprotein E2; antigen identified by monoclonal 12E7, Y homolog; antigen identified by monoclonal antibodies 12E7, F21 and O13; cell surface antigen 12E7; cell surface antigen HBA-71; cell surface antigen O13; surface antigen MIC2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgcggggctgcgctggcgctgctgctcttcggcctgctgggtgttctggtcgccgccccggatggtggtttcgatttatctgatgcccttcctgacaatgaaaacaagaaacccactgcaatccccaagaaacccagtgctggggatgactttgacttaggagatgctgttgttgatggagaaaatgacgacccacgaccaccgaacccacccaaaccgatgccaaatccaaaccccaaccaccctagttcctccggtagcttttcagatgctgaccttgcggatggcgtttcaggtggagaaggaaaaggaggcagtgatggtggaggcagccacaggaaagaaggggaagaggccgacgccccaggcgtgatccccgggattgtgggggctgtcgtggtcgccgtggctggagccatctctagcttcattgcttaccagaaaaagaagctatgcttcaaagaaaatgcagaacaaggggaggtggacatggagagccaccggaatgccaacgcagagccagctgttcagcgtactcttttagagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - orosomucoid 2
- BCL2-like 1
- CD81 molecule
- CD58 molecule

Buy CD99-CD99 molecule Gene now

Add to cart