ORM2-orosomucoid 2 Gene View larger

ORM2-orosomucoid 2 Gene

PTXBC015964

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ORM2-orosomucoid 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ORM2-orosomucoid 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015964
Product type: DNA & cDNA
Ncbi symbol: ORM2
Origin species: Human
Product name: ORM2-orosomucoid 2 Gene
Size: 2ug
Accessions: BC015964
Gene id: 5005
Gene description: orosomucoid 2
Synonyms: AGP-B; AGP-B'; AGP2; alpha-1-acid glycoprotein 2; AGP 2; OMD 2; alpha-1-acid glycoprotein, type 2; orosomucoid 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgtcctgggttcttacagtcctgagcctcctacctctgctggaagcccagatcccattgtgtgccaacctagtaccggtgcccatcaccaacgccaccctggaccggatcactggcaagtggttttatatcgcatcggcctttcgaaacgaggagtacaataagtcggttcaggagatccaagcaaccttcttttactttacccccaacaagacagaggacacgatctttctcagagagtaccagacccgccagaaccagtgcttctataactccagttacctgaatgtccagcgggagaatgggaccgtctccagatacgagggaggccgagaacatgttgctcacctgctgttccttagggacaccaagaccttgatgtttggttcctacctggacgatgagaagaactgggggctgtctttctatgctgacaagccagagacgaccaaggagcaactgggagagttctacgaagctctcgactgcttgtgcattcccaggtcagatgtcatgtacaccgactggaaaaaggataagtgtgagccactggagaagcagcacgagaaggagaggaaacaggaggagggggaatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2-like 1
- CD81 molecule
- CD58 molecule
- CD48 molecule

Buy ORM2-orosomucoid 2 Gene now

Add to cart