Login to display prices
Login to display prices
CD58-CD58 molecule Gene View larger

CD58-CD58 molecule Gene

PTXBC005930

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD58-CD58 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD58-CD58 molecule Gene

Proteogenix catalog: PTXBC005930
Ncbi symbol: CD58
Product name: CD58-CD58 molecule Gene
Size: 2ug
Accessions: BC005930
Gene id: 965
Gene description: CD58 molecule
Synonyms: CD58 molecule; CD58 antigen, (lymphocyte function-associated antigen 3); LFA-3; LFA3; ag3; lymphocyte function-associated antigen 3; surface glycoprotein LFA-3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgctgggagcgacgcggggcgggccctgggggtcctcagcgtggtctgcctgctgcactgctttggtttcatcagctgtttttcccaacaaatatatggtgttgtgtatgggaatgtaactttccatgtaccaagcaatgtgcctttaaaagaggtcctatggaaaaaacaaaaggataaagttgcagaactggaaaattctgaattcagagctttctcatcttttaaaaatagggtttatttagacactgtgtcaggtagcctcactatctacaacttaacatcatcagatgaagatgagtatgaaatggaatcgccaaatattactgataccatgaagttctttctttatgtgcttgagtctcttccatctcccacactaacttgtgcattgactaatggaagcattgaagtccaatgcatgataccagagtattacaacagccatcgaggacttataatgtactcatgggattgtcctatggagcaatgtaaacgtaactcaaccagtatatattttaagatggaaaatgatcttccacaaaaaatacagtgtactcttagcaatccattatttaatacaacatcatcaatcattttgacaacctgtatcccaagcagcggtcattcaagacacagatatgcacttatacccataccattagcagtaattacaacatgtattgtgctgtatatgaatggtatgtatgctttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: