BCL2L1-BCL2-like 1 Gene View larger

BCL2L1-BCL2-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCL2L1-BCL2-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BCL2L1-BCL2-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019307
Product type: DNA & cDNA
Ncbi symbol: BCL2L1
Origin species: Human
Product name: BCL2L1-BCL2-like 1 Gene
Size: 2ug
Accessions: BC019307
Gene id: 598
Gene description: BCL2-like 1
Synonyms: BCL-XL/S; BCL2L; BCLX; Bcl-X; PPP1R52; bcl-2-like protein 1; apoptosis regulator Bcl-X; protein phosphatase 1, regulatory subunit 52; BCL2 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaacccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD81 molecule
- CD58 molecule
- CD48 molecule
- tropomyosin 3

Buy BCL2L1-BCL2-like 1 Gene now

Add to cart