CD81-CD81 molecule Gene View larger

CD81-CD81 molecule Gene

PTXBC002978

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD81-CD81 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD81-CD81 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002978
Product type: DNA & cDNA
Ncbi symbol: CD81
Origin species: Human
Product name: CD81-CD81 molecule Gene
Size: 2ug
Accessions: BC002978
Gene id: 975
Gene description: CD81 molecule
Synonyms: CD81 molecule; CD81 antigen (target of antiproliferative antibody 1); CD81 antigen; CVID6; S5.7; TAPA1; TSPAN28; 26 kDa cell surface protein TAPA-1; tetraspanin-28; tspan-28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagtggagggctgcaccaagtgcatcaagtacctgctcttcgtcttcaatttcgtcttctggctggctggaggcgtgatcctgggtgtggccctgtggctccgccatgacccgcagaccaccaacctcctgtatctggagctgggagacaagcccgcgcccaacaccttctatgtaggcatctacatcctcatcgctgtgggcgctgtcatgatgttcgttggcttcctgggctgctacggggccatccaggaatcccagtgcctgctggggacgttcttcacctgcctggtcatcctgtttgcctgtgaggtggccgccggcatctggggctttgtcaacaaggaccagatcgccaaggatgtgaagcagttctatgaccaggccctacagcaggccgtggtggatgatgacgccaacaacgccaaggctgtggtgaagaccttccacgagacgcttgactgctgtggctccagcacactgactgctttgaccacctcagtgctcaagaacaatttgtgtccctcgggcagcaacatcatcagcaacctcttcaaggaggactgccaccagaagatcgatgacctcttctccgggaagctgtacctcatcggcattgctgccatcgtggtcgctgtgatcatgatcttcgagatgatcctgagcatggtgctgtgctgtggcatccggaacagctccgtgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD58 molecule
- CD48 molecule
- tropomyosin 3
- mucolipin 1

Buy CD81-CD81 molecule Gene now

Add to cart