HAT1-histone acetyltransferase 1 Gene View larger

HAT1-histone acetyltransferase 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAT1-histone acetyltransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HAT1-histone acetyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018682
Product type: DNA & cDNA
Ncbi symbol: HAT1
Origin species: Human
Product name: HAT1-histone acetyltransferase 1 Gene
Size: 2ug
Accessions: BC018682
Gene id: 8520
Gene description: histone acetyltransferase 1
Synonyms: KAT1; histone acetyltransferase type B catalytic subunit; histone acetyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgattttgactccatttcaaggtcaaggccatggtgctcaacttcttgaaacagttcatagatactacactgaatttcctacagttcttgatattacagcggaagatccatccaaaagctatgtgaaattacgagactttgtgcttgtgaagctttgtcaagatttgccctgtttttcccgggaaaaattaatgcaaggattcaatgaagatatggcgatagaggcacaacagaagttcaaaataaataagcaacacgctagaagggtttatgaaattcttcgactactggtaactgacatgagtgatgccgaacaatacagaagctacagactggatattaaaagaagactaattagcccatataagaaaaagcagagagatcttgctaagatgagaaaatgtctcagaccagaagaactgacaaaccagatgaaccaaatagaaataagcatgcaacatgaacagctggaagagagttttcaggaactagtggaagattaccggcgtgttattgaacgacttgctcaagagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEP domain containing 1B
- LMBR1 domain containing 1
- ankyrin repeat domain 22
- kinesin family member 26A

Buy HAT1-histone acetyltransferase 1 Gene now

Add to cart