Login to display prices
Login to display prices
ANKRD22-ankyrin repeat domain 22 Gene View larger

ANKRD22-ankyrin repeat domain 22 Gene

PTXBC021671

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRD22-ankyrin repeat domain 22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRD22-ankyrin repeat domain 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021671
Product type: DNA & cDNA
Ncbi symbol: ANKRD22
Origin species: Human
Product name: ANKRD22-ankyrin repeat domain 22 Gene
Size: 2ug
Accessions: BC021671
Gene id: 118932
Gene description: ankyrin repeat domain 22
Synonyms: ankyrin repeat domain-containing protein 22; ankyrin repeat domain 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaatcctatactctgagcccatctgccaagcagcctatcagaatgactttggacaagtgtggcggtgggtgaaagaagacagcagctatgccaacgttcaagatggctttaatggagacacgcccctgatctgtgcttgcaggcgagggcatgtgagaatcgtttccttccttttaagaagaaatgctaatgtcaacctcaaaaaccagaaagagagaacctgcttgcatcatgctgtgaagaaaaaatttaccttcattgattatctactaattatcctcttaatgcctgttctgcttattgggtatttcctcatggtatcaaagacaaagcagaatgaggctcttgtacgaatgctacttgatgctggtgtcgaagttaatgctacagattgttatggctgtaccgcattacattatgcctgtgaaatgaaaaaccagtctcttatccctctgctcttggaagcccgtgcagaccccacaataaagaataagcatggtgagagctcactggatattgcacggagattaaaattttcccagattgaattaatgctaaggaaagcattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kinesin family member 26A
- ankyrin repeat domain 10
- sperm associated antigen 7
- serine/threonine kinase 40