Login to display prices
Login to display prices
SPAG7-sperm associated antigen 7 Gene View larger

SPAG7-sperm associated antigen 7 Gene

PTXBC011934

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPAG7-sperm associated antigen 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPAG7-sperm associated antigen 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011934
Product type: DNA & cDNA
Ncbi symbol: SPAG7
Origin species: Human
Product name: SPAG7-sperm associated antigen 7 Gene
Size: 2ug
Accessions: BC011934
Gene id: 9552
Gene description: sperm associated antigen 7
Synonyms: ACRP; FSA-1; sperm-associated antigen 7; sperm associated antigen 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacctactgggctccatcctgagctccatggagaagccacccagcctcggtgaccaggagactcggcgcaaggcccgagaacaggccgcccgcctgaagaaactacaagagcaagagaaacaacagaaagtggagtttcgtaaaaggatggagaaggaggtgtcagatttcattcaagacagtgggcagatcaagaaaaagtttcagccaatgaacaagatcgagaggagcatactacatgatgtggtggaagtggctggcctgacatccttctcctttggggaagatgatgactgtcgctatgtcatgatcttcaaaaaggagtttgcaccctcagatgaagagctagactcttaccgtcgtggagaggaatgggacccccagaaggctgaggagaagcggaagctgaaggagctggcccagaggcaagaggaggaggcagcccagcaggggcctgtggtggtgagccctgccagcgactacaaggacaagtacagccacctcatcggcaagggagcagccaaagacgcagcccacatgctacaggccaataagacctacggctgtgtgcccgtggccaataagagggacacacgctccattgaagaggctatgaatgagatcagagccaagaagcgtctgcggcagagtggggaagagttgccgccaacctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine kinase 40
- lysophospholipase-like 1
- triosephosphate isomerase 1
- serine/threonine kinase 16