STK16-serine/threonine kinase 16 Gene View larger

STK16-serine/threonine kinase 16 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STK16-serine/threonine kinase 16 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STK16-serine/threonine kinase 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002618
Product type: DNA & cDNA
Ncbi symbol: STK16
Origin species: Human
Product name: STK16-serine/threonine kinase 16 Gene
Size: 2ug
Accessions: BC002618
Gene id: 8576
Gene description: serine/threonine kinase 16
Synonyms: tyrosine-protein kinase STK16; KRCT; MPSK; PSK; TSF1; hPSK; serine/threonine-protein kinase 16; TGF-beta-stimulated factor 1; myristoylated and palmitoylated serine/threonine-protein kinase; protein kinase PKL12; protein kinase expressed in day 12 fetal liver; serine/threonine kinase 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccacgcgctgtgtgtctgctctcggggaactgtcatcattgacaataagcgctacctcttcatccagaaactgggggagggtgggttcagctatgtggacctagtggaagggttacatgatggacacttctacgccctgaagcgaatcctgtgtcacgagcagcaggaccgggaggaggcccagcgagaagccgacatgcatcgcctcttcaatcaccccaacatccttcgcctcgtggcttactgtctgagggaacggggtgctaagcatgaggcctggctgctgctaccattcttcaagagaggtacgctgtggaatgagatagaaaggctgaaggacaaaggcaacttcctgaccgaggatcaaatcctttggctgctgctggggatctgcagaggccttgaggccattcatgccaagggttatgcccacagagacttgaagcccaccaatatattgcttggagatgaggggcagccagttttaatggacttgggttccatgaatcaagcatgcatccatgtggagggctcccgccaggctctgaccctgcaggactgggcagcccagcggtgcaccatctcctaccgagccccagagctcttctctgtgcagagtcactgtgtcatcgatgagcggactgatgtctggtccctaggctgcgtgctatatgccatgatgtttggggaaggcccttatgacatggtgttccaaaagggtgacagtgtggcccttgctgtgcagaaccaactcagcatcccacaaagccccaggcattcttcagcattgtggcagctcctgaactcgatgatgaccgtggacccgcatcagcgtcctcacattcctctcctcctcagtcagctggaggcgctgcagcccccagctcctggccaacatactacccaaatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DDRGK domain containing 1
- hyaluronoglucosaminidase 2
- carnitine acetyltransferase
- RNA binding motif protein 5

Buy STK16-serine/threonine kinase 16 Gene now

Add to cart