HYAL2-hyaluronoglucosaminidase 2 Gene View larger

HYAL2-hyaluronoglucosaminidase 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HYAL2-hyaluronoglucosaminidase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HYAL2-hyaluronoglucosaminidase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000692
Product type: DNA & cDNA
Ncbi symbol: HYAL2
Origin species: Human
Product name: HYAL2-hyaluronoglucosaminidase 2 Gene
Size: 2ug
Accessions: BC000692
Gene id: 8692
Gene description: hyaluronoglucosaminidase 2
Synonyms: LUCA2; hyaluronidase-2; PH-20 homolog; PH20 homolog; hyal-2; lung carcinoma protein 2; lysosomal hyaluronidase; hyaluronoglucosaminidase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggcaggcccaggccccaccgttacattggccctggtgctggcggtggcatgggccatggagctcaagcccacagcaccacccatcttcactggccggccctttgtggtagcgtgggacgtgcccacacaggactgtggcccacgcctcaaggtgccactggacctgaatgcctttgatgtgcaggcctcacctaatgagggttttgtgaaccagaatattaccatcttctaccgcgaccgtctaggcctgtatccacgcttcgattctgccggaaggtctgtgcatggtggtgtgccacagaatgtcagcctttgggcacaccggaagatgctgcagaaacgtgtggagcactacattcggacacaggagtctgcggggctggcggtcatcgactgggaggactggcgacctgtgtgggtgcgcaactggcaggacaaagatgtgtatcgccggttatcacgccagctagtggccagtcgtcaccctgactggcctccagaccgcatagtcaaacaggcacaatatgagtttgagttcgcagcacagcagttcatgctggagacactgcgttatgtcaaggcagtgcggccccggcacctctggggcttctacctctttcctgactgctacaatcatgattatgtgcagaactgggagagctacacaggccgctgccctgatgttgaggtggcccgcaatgaccagctggcctggctgtgggctgagagcacggccctcttcccgtctgtctacctggacgagacacttgcttcctcccgccatggccgcaactttgtgagcttccgtgttcaggaggcccttcgtgtggctcgcacccaccatgccaaccatgcactcccagtctacgtcttcacacgacccacctacagccgcaggctcacggggcttagtgagatggacctcatctctaccattggcgagagtgcggccctgggcgcagctggtgtcatcctctggggtgacgcggggtacaccacaagcacggagacctgccagtacctcaaagattacctgacacggctgctggtcccctacgtggtcaatgtgtcctgggccacccaatattgcagccgggcccagtgccatggccatgggcgctgtgtgcgccgcaaccccagtgccagtaccttcctgcatctcagcaccaacagtttccgcctagtgcctggccatgcacctggtgaaccccagctgcgacctgtgggggagctcagttgggccgacattgaccacctgcagacacacttccgctgccagtgctacttgggctggagtggtgagcaatgccagtgggaccataggcaggcagctggaggtgccagcgaggcctgggctgggtcccacctcaccagtctgctggctctggcagccctggcctttacctggaccttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carnitine acetyltransferase
- RNA binding motif protein 5
- asparaginyl-tRNA synthetase
- heat shock 70kDa protein 2

Buy HYAL2-hyaluronoglucosaminidase 2 Gene now

Add to cart