TPI1-triosephosphate isomerase 1 Gene View larger

TPI1-triosephosphate isomerase 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPI1-triosephosphate isomerase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPI1-triosephosphate isomerase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007086
Product type: DNA & cDNA
Ncbi symbol: TPI1
Origin species: Human
Product name: TPI1-triosephosphate isomerase 1 Gene
Size: 2ug
Accessions: BC007086
Gene id: 7167
Gene description: triosephosphate isomerase 1
Synonyms: HEL-S-49; TIM; TPI; TPID; triosephosphate isomerase; epididymis secretory protein Li 49; triose-phosphate isomerase; triosephosphate isomerase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgccctccaggaagttcttcgttgggggaaactggaagatgaacgggcggaagcagagtctgggggagctcatcggcactctgaacgcggccaaggtgccggccgacaccgaggtggtttgtgctccccctactgcctatatcgacttcgcccggcagaagctagatcccaagattgctgtggctgcgcagaactgctacaaagtgactaatggggcttttactggggagatcagccctggcatgatcaaagactgcggagccacgtgggtggtcctggggcactcagagagaaggcatgtctttggggagtcagatgagctgattgggcagaaagtggcccatgctctggcagagggactcggagtaatcgcctgcattggggagaagctagatgaaagggaagctggcatcactgagaaggttgttttcgagcagacaaaggtcatcgcagataacgtgaaggactggagcaaggtcgtcctggcctatgagcctgtgtgggccattggtactggcaagactgcaacaccccaacaggcccaggaagtacacgagaagctccgaggatggctgaagtccaacgtctctgatgcggtggctcagagcacccgtatcatttatggaggctctgtgactggggcaacctgcaaggagctggccagccagcctgatgtggatggcttccttgtgggtggtgcttccctcaagcccgaattcgtggacatcatcaatgccaaacaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine kinase 16
- DDRGK domain containing 1
- hyaluronoglucosaminidase 2
- carnitine acetyltransferase

Buy TPI1-triosephosphate isomerase 1 Gene now

Add to cart