LYPLAL1-lysophospholipase-like 1 Gene View larger

LYPLAL1-lysophospholipase-like 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYPLAL1-lysophospholipase-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LYPLAL1-lysophospholipase-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016711
Product type: DNA & cDNA
Ncbi symbol: LYPLAL1
Origin species: Human
Product name: LYPLAL1-lysophospholipase-like 1 Gene
Size: 2ug
Accessions: BC016711
Gene id: 127018
Gene description: lysophospholipase-like 1
Synonyms: Q96AV0; lysophospholipase-like protein 1; lysophospholipase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgcgtcggggtcggttctgcagcgctgtatcgtgtcgccggcagggaggcatagcgcctctctgatcttcctgcatggctcaggtgattctggacaaggattaagaatgtggatcaagcaggttttaaatcaagatttaacattccaacacataaaaattatttatccaacagctcctcccagatcatatactcctatgaaaggaggaatctccaatgtatggtttgacagatttaaaataaccaatgactgcccagaacaccttgaatcaattgatgtcatgtgtcaagtgcttactgatttgattgatgaagaagtaaaaagtggcatcaagaagaacaggatattaataggaggattctctatgggaggatgcatggcaatgcatttagcatatagaaatcatcaagatgtggcaggagtatttgctctttctagttttctgaataaagcatctgctgtttaccaggctcttcagaagagtaatggtgtacttcctgaattatttcagtgtcatggtactgcagatgagttagttcttcattcttgggcagaagagacaaactcaatgttaaaatctctaggagtgaccacgaagtttcatagttttccaaatgtttaccatgagctaagcaaaactgagttagacatattgaagttatggattcttacaaagctgccaggagaaatggaaaaacaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - triosephosphate isomerase 1
- serine/threonine kinase 16
- DDRGK domain containing 1
- hyaluronoglucosaminidase 2

Buy LYPLAL1-lysophospholipase-like 1 Gene now

Add to cart