KIF26A-kinesin family member 26A Gene View larger

KIF26A-kinesin family member 26A Gene

PTXBC009415

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIF26A-kinesin family member 26A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIF26A-kinesin family member 26A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009415
Product type: DNA & cDNA
Ncbi symbol: KIF26A
Origin species: Human
Product name: KIF26A-kinesin family member 26A Gene
Size: 2ug
Accessions: BC009415
Gene id: 26153
Gene description: kinesin family member 26A
Synonyms: KIF26A variant protein; kinesin-like protein KIF26A; kinesin family member 26A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgagagtggggctgcctccccaggcgcccgcacccgcagcctcaagtcccccaagaagagggccacaggtctgcagcggcggcgcctgattcccgccccactgcccgacaccactgccctgggccgtaagcccagcctccccgggcagtgggtggacctgcccccgcccctggctggctccctgaaggagccgttcgagatcaaggtgtacgagatcgatgacgtggagcgccttcagcggccccgccccaccccgagggaggcccccacccagggtctggcgtgcgtcagtacaaggctgcggctggcggagcgcaggcagcagcggctgcgggaggtgcaggccaagcacaagcacctgtgtgaggagctggccgagacccagggccggctgatgctggagcctggccgctggctggagcagtttgaggtggacccggagctggagcccgagtcggccgagtacctggcggccctggagcgagccacggcggccctggagcagtgcgtgaacctgtgcaaggcgcacgtcatgatggtcacctgcttcgacatcagcgttgcagccagtgctgccatcccggggccgcaggaggtggacgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat domain 10
- sperm associated antigen 7
- serine/threonine kinase 40
- lysophospholipase-like 1

Buy KIF26A-kinesin family member 26A Gene now

Add to cart