Login to display prices
Login to display prices
KIF26A-kinesin family member 26A Gene View larger

KIF26A-kinesin family member 26A Gene

PTXBC009415

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIF26A-kinesin family member 26A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIF26A-kinesin family member 26A Gene

Proteogenix catalog: PTXBC009415
Ncbi symbol: KIF26A
Product name: KIF26A-kinesin family member 26A Gene
Size: 2ug
Accessions: BC009415
Gene id: 26153
Gene description: kinesin family member 26A
Synonyms: KIF26A variant protein; kinesin-like protein KIF26A; kinesin family member 26A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgagagtggggctgcctccccaggcgcccgcacccgcagcctcaagtcccccaagaagagggccacaggtctgcagcggcggcgcctgattcccgccccactgcccgacaccactgccctgggccgtaagcccagcctccccgggcagtgggtggacctgcccccgcccctggctggctccctgaaggagccgttcgagatcaaggtgtacgagatcgatgacgtggagcgccttcagcggccccgccccaccccgagggaggcccccacccagggtctggcgtgcgtcagtacaaggctgcggctggcggagcgcaggcagcagcggctgcgggaggtgcaggccaagcacaagcacctgtgtgaggagctggccgagacccagggccggctgatgctggagcctggccgctggctggagcagtttgaggtggacccggagctggagcccgagtcggccgagtacctggcggccctggagcgagccacggcggccctggagcagtgcgtgaacctgtgcaaggcgcacgtcatgatggtcacctgcttcgacatcagcgttgcagccagtgctgccatcccggggccgcaggaggtggacgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: