Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DEPDC1B-DEP domain containing 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DEPDC1B-DEP domain containing 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010904 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DEPDC1B |
| Origin species: | Human |
| Product name: | DEPDC1B-DEP domain containing 1B Gene |
| Size: | 2ug |
| Accessions: | BC010904 |
| Gene id: | 55789 |
| Gene description: | DEP domain containing 1B |
| Synonyms: | BRCC3; XTP1; DEP domain-containing protein 1B; HBV X-transactivated gene 8 protein; HBV XAg-transactivated protein 8; HBxAg transactivated protein 1; breast cancer cell 3; DEP domain containing 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccacccctgtgtgatggctttggtacccgaacactgatggttcagacattttcccgttgcatcttgtgttccaaggatgaagtggacttggatgagttattagctgctagattggtaacgtttctgatggacaattaccaggaaattctgaaagtccctttggccttgcagacctctatagaggagcgtgtggctcatctacgaagagtccagataaaatacccaggagctgatatggatatcactttatctgctccatcattttgccgtcaaattagtccagaggaatttgaatatcaaagatcatatggctctcaggaacctctggcagccttgttggaggaagtcataacagatgccaaactctccaacaaagagaaaaagaagaaactgaagcagtttcagaaatcctatcctgaagtctatcaagaacgatttcctacaccagaaagtgcagcacttctgtttcctgaaaaacccaaaccgaaaccacagctgctaatgtgggcactaaagaagcctttccaaccatttcaaagaactagaagttttcgaatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LMBR1 domain containing 1 - ankyrin repeat domain 22 - kinesin family member 26A - ankyrin repeat domain 10 |