DEPDC1B-DEP domain containing 1B Gene View larger

DEPDC1B-DEP domain containing 1B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DEPDC1B-DEP domain containing 1B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DEPDC1B-DEP domain containing 1B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010904
Product type: DNA & cDNA
Ncbi symbol: DEPDC1B
Origin species: Human
Product name: DEPDC1B-DEP domain containing 1B Gene
Size: 2ug
Accessions: BC010904
Gene id: 55789
Gene description: DEP domain containing 1B
Synonyms: BRCC3; XTP1; DEP domain-containing protein 1B; HBV X-transactivated gene 8 protein; HBV XAg-transactivated protein 8; HBxAg transactivated protein 1; breast cancer cell 3; DEP domain containing 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccacccctgtgtgatggctttggtacccgaacactgatggttcagacattttcccgttgcatcttgtgttccaaggatgaagtggacttggatgagttattagctgctagattggtaacgtttctgatggacaattaccaggaaattctgaaagtccctttggccttgcagacctctatagaggagcgtgtggctcatctacgaagagtccagataaaatacccaggagctgatatggatatcactttatctgctccatcattttgccgtcaaattagtccagaggaatttgaatatcaaagatcatatggctctcaggaacctctggcagccttgttggaggaagtcataacagatgccaaactctccaacaaagagaaaaagaagaaactgaagcagtttcagaaatcctatcctgaagtctatcaagaacgatttcctacaccagaaagtgcagcacttctgtttcctgaaaaacccaaaccgaaaccacagctgctaatgtgggcactaaagaagcctttccaaccatttcaaagaactagaagttttcgaatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LMBR1 domain containing 1
- ankyrin repeat domain 22
- kinesin family member 26A
- ankyrin repeat domain 10

Buy DEPDC1B-DEP domain containing 1B Gene now

Add to cart