LMBRD1-LMBR1 domain containing 1 Gene View larger

LMBRD1-LMBR1 domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMBRD1-LMBR1 domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LMBRD1-LMBR1 domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010360
Product type: DNA & cDNA
Ncbi symbol: LMBRD1
Origin species: Human
Product name: LMBRD1-LMBR1 domain containing 1 Gene
Size: 2ug
Accessions: BC010360
Gene id: 55788
Gene description: LMBR1 domain containing 1
Synonyms: C6orf209; LMBD1; MAHCF; NESI; HDAg-L-interacting protein NESI; hepatitis delta antigen-L interacting protein; liver regeneration p-53 related protein; nuclear export signal-interacting protein; LMBR1 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggcagctataacttacacagcctatggcatgtctgcgttacctttaaatctgataaaaggcactagaagcgctgcttatgaacgtttggaaaacactgaagacattgaagaagtagaacaacacattcaaacgattaaatcaaaaagcaaagatggtcgacctttgccagcaagggataaacgcgccttaaaacaatttgaagaaaggttacgaacacttaagaagagagagaggcatttagaattcattgaaaacagctggtggacaaaattttgtggcgctctgcgtcccctgaagatcgtctggggaatatttttcatcttagttgcattgctgtttgtaatttctctcttcttgtcaaatttagataaagctcttcattcagctggaatagattctggtttcataatttttggagctaacctgagtaatccactgaatatgcttttgcctttactacaaacagaattcgaaatattggcatatggttcttttggattagattatataaaatcagaagaggtagaaccaggccccaagcactcctttttctctgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat domain 22
- kinesin family member 26A
- ankyrin repeat domain 10
- sperm associated antigen 7

Buy LMBRD1-LMBR1 domain containing 1 Gene now

Add to cart