Login to display prices
Login to display prices
LMBRD1-LMBR1 domain containing 1 Gene View larger

LMBRD1-LMBR1 domain containing 1 Gene

PTXBC010360

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMBRD1-LMBR1 domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LMBRD1-LMBR1 domain containing 1 Gene

Proteogenix catalog: PTXBC010360
Ncbi symbol: LMBRD1
Product name: LMBRD1-LMBR1 domain containing 1 Gene
Size: 2ug
Accessions: BC010360
Gene id: 55788
Gene description: LMBR1 domain containing 1
Synonyms: C6orf209; LMBD1; MAHCF; NESI; HDAg-L-interacting protein NESI; hepatitis delta antigen-L interacting protein; liver regeneration p-53 related protein; nuclear export signal-interacting protein; LMBR1 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggcagctataacttacacagcctatggcatgtctgcgttacctttaaatctgataaaaggcactagaagcgctgcttatgaacgtttggaaaacactgaagacattgaagaagtagaacaacacattcaaacgattaaatcaaaaagcaaagatggtcgacctttgccagcaagggataaacgcgccttaaaacaatttgaagaaaggttacgaacacttaagaagagagagaggcatttagaattcattgaaaacagctggtggacaaaattttgtggcgctctgcgtcccctgaagatcgtctggggaatatttttcatcttagttgcattgctgtttgtaatttctctcttcttgtcaaatttagataaagctcttcattcagctggaatagattctggtttcataatttttggagctaacctgagtaatccactgaatatgcttttgcctttactacaaacagaattcgaaatattggcatatggttcttttggattagattatataaaatcagaagaggtagaaccaggccccaagcactcctttttctctgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: