Login to display prices
Login to display prices
SSH2-slingshot homolog 2 (Drosophila) Gene View larger

SSH2-slingshot homolog 2 (Drosophila) Gene

PTXBC011636

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SSH2-slingshot homolog 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SSH2-slingshot homolog 2 (Drosophila) Gene

Proteogenix catalog: PTXBC011636
Ncbi symbol: SSH2
Product name: SSH2-slingshot homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC011636
Gene id: 85464
Gene description: slingshot homolog 2 (Drosophila)
Synonyms: SSH-2; SSH-2L; protein phosphatase Slingshot homolog 2; SSH-like protein 2; slingshot protein phosphatase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattccttacttctccgccaacgcggtcatctcgcagaacgccatcaaccagctcatcagcgagagctttctaactgtcaaaggtgctgccctttttctaccacggggaaatggctcatccacaccaagaatcagccacagacggaacaagcatgcaggcgatctccaacagcatctccaagcaatgttcattttactccgcccagaagacaacatcaggctggctgtaagactggaaagtacttaccagaatcgaacacgctatatggtagtggtttcaactaatggtagacaagacactgaagaaagcatcgtcctaggaatggatttctcctctaatgacagtagcacttgtaccatgggcttagttttgcctctctggagcgacacgctaattcatttggatggtgatggtgggttcagtgtatcgacggataacagagttcacatattcaaacctgtatctgtgcaggcaatgtgggttgacagggattcaaggaacaaacactgtgatgtactattggtggaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: