FAM163A-family with sequence similarity 163, member A Gene View larger

FAM163A-family with sequence similarity 163, member A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM163A-family with sequence similarity 163, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM163A-family with sequence similarity 163, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009382
Product type: DNA & cDNA
Ncbi symbol: FAM163A
Origin species: Human
Product name: FAM163A-family with sequence similarity 163, member A Gene
Size: 2ug
Accessions: BC009382
Gene id: 148753
Gene description: family with sequence similarity 163, member A
Synonyms: protein FAM163A; A230106N23Rik; cebelin; family with sequence similarity 163, member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagcgggaacggttgtgatcactggcggaatcctagctacggtgatcctcctctgcatcattgccgtcctgtgctactgcaggctccagtattactgctgcaagaagagcggaaccgaggttgcagacgaggaggaggagcgggagcacgaccttcccacgcatcccagaggccccacctgcaatgcctgcagctcccaagccctggacggcagaggcagcctggcgcctctcaccagcgagccctgcagccagccctgtggggtggccgcgagccactgcactacctgctccccatacagctcccccttttacatacggacggctgacatggtgcccaatgggggtggaggcgagaggctctcctttgctcccacatactacaaagaggggggacccccatccctcaaattggcagcaccccagagttacccggtgacctggccaggctctgggcgtgaggccttcaccaatccaagggctattagtacagacgtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2/adenovirus E1B 19kDa interacting protein 3
- N-acetyltransferase 14 (GCN5-related, putative)
- nuclear receptor subfamily 1, group I, member 2
- family with sequence similarity 151, member A

Buy FAM163A-family with sequence similarity 163, member A Gene now

Add to cart