No products
Prices are tax excluded
PTXBC009382
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009382 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM163A |
| Origin species: | Human |
| Product name: | FAM163A-family with sequence similarity 163, member A Gene |
| Size: | 2ug |
| Accessions: | BC009382 |
| Gene id: | 148753 |
| Gene description: | family with sequence similarity 163, member A |
| Synonyms: | protein FAM163A; A230106N23Rik; cebelin; family with sequence similarity 163, member A |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacagcgggaacggttgtgatcactggcggaatcctagctacggtgatcctcctctgcatcattgccgtcctgtgctactgcaggctccagtattactgctgcaagaagagcggaaccgaggttgcagacgaggaggaggagcgggagcacgaccttcccacgcatcccagaggccccacctgcaatgcctgcagctcccaagccctggacggcagaggcagcctggcgcctctcaccagcgagccctgcagccagccctgtggggtggccgcgagccactgcactacctgctccccatacagctcccccttttacatacggacggctgacatggtgcccaatgggggtggaggcgagaggctctcctttgctcccacatactacaaagaggggggacccccatccctcaaattggcagcaccccagagttacccggtgacctggccaggctctgggcgtgaggccttcaccaatccaagggctattagtacagacgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2/adenovirus E1B 19kDa interacting protein 3 - N-acetyltransferase 14 (GCN5-related, putative) - nuclear receptor subfamily 1, group I, member 2 - family with sequence similarity 151, member A |