Login to display prices
Login to display prices
FAM163A-family with sequence similarity 163, member A Gene View larger

FAM163A-family with sequence similarity 163, member A Gene

PTXBC009382

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM163A-family with sequence similarity 163, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM163A-family with sequence similarity 163, member A Gene

Proteogenix catalog: PTXBC009382
Ncbi symbol: FAM163A
Product name: FAM163A-family with sequence similarity 163, member A Gene
Size: 2ug
Accessions: BC009382
Gene id: 148753
Gene description: family with sequence similarity 163, member A
Synonyms: protein FAM163A; A230106N23Rik; cebelin; family with sequence similarity 163, member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagcgggaacggttgtgatcactggcggaatcctagctacggtgatcctcctctgcatcattgccgtcctgtgctactgcaggctccagtattactgctgcaagaagagcggaaccgaggttgcagacgaggaggaggagcgggagcacgaccttcccacgcatcccagaggccccacctgcaatgcctgcagctcccaagccctggacggcagaggcagcctggcgcctctcaccagcgagccctgcagccagccctgtggggtggccgcgagccactgcactacctgctccccatacagctcccccttttacatacggacggctgacatggtgcccaatgggggtggaggcgagaggctctcctttgctcccacatactacaaagaggggggacccccatccctcaaattggcagcaccccagagttacccggtgacctggccaggctctgggcgtgaggccttcaccaatccaagggctattagtacagacgtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: