Login to display prices
Login to display prices
MYL2-myosin, light chain 2, regulatory, cardiac, slow Gene View larger

MYL2-myosin, light chain 2, regulatory, cardiac, slow Gene

PTXBC015821

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYL2-myosin, light chain 2, regulatory, cardiac, slow Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYL2-myosin, light chain 2, regulatory, cardiac, slow Gene

Proteogenix catalog: PTXBC015821
Ncbi symbol: MYL2
Product name: MYL2-myosin, light chain 2, regulatory, cardiac, slow Gene
Size: 2ug
Accessions: BC015821
Gene id: 4633
Gene description: myosin, light chain 2, regulatory, cardiac, slow
Synonyms: CMH10; MLC-2s/v; MLC2; myosin regulatory light chain 2, ventricular/cardiac muscle isoform; MLC-2; MLC-2v; RLC of myosin; cardiac myosin light chain 2; cardiac ventricular myosin light chain 2; myosin light chain 2, slow skeletal/ventricular muscle isoform; myosin, light chain 2, regulatory, cardiac, slow; myosin, light polypeptide 2, regulatory, cardiac, slow; regulatory light chain of myosin; slow cardiac myosin regulatory light chain 2; ventricular myosin light chain 2; myosin light chain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacctaagaaagcaaagaagagagccgggggcgccaactccaacgtgttctccatgttcgaacagacccaaatccaggaatttaaggaggccttcactatcatggaccagaacagggatggcttcattgacaagaacgatctgagagacacctttgctgcccttgggcgagtgaacgtgaaaaatgaagaaattgatgaaatgatcaaggaggctccgggtccaattaactttactgtgttcctcacaatgtttggggagaaacttaagggagcggaccctgaggaaaccattctcaacgcattcaaagtgtttgaccctgaaggcaaaggggtgctgaaggctgattacgttcgggaaatgctgaccacgcaggcggagaggttttccaaggaggaggttgaccagatgttcgccgccttcccccctgacgtgactggcaacttggactacaagaacctggtgcacatcatcacccacggagaagagaaggactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: