Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GADD45A-growth arrest and DNA-damage-inducible, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GADD45A-growth arrest and DNA-damage-inducible, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011757 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GADD45A |
| Origin species: | Human |
| Product name: | GADD45A-growth arrest and DNA-damage-inducible, alpha Gene |
| Size: | 2ug |
| Accessions: | BC011757 |
| Gene id: | 1647 |
| Gene description: | growth arrest and DNA-damage-inducible, alpha |
| Synonyms: | DDIT1; GADD45; growth arrest and DNA damage-inducible protein GADD45 alpha; DDIT-1; DNA damage-inducible transcript 1 protein; DNA damage-inducible transcript-1; growth arrest and DNA-damage-inducible 45 alpha; growth arrest and DNA damage inducible alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactttggaggaattctcggctggagagcagaagaccgaaaggatggataaggtgggggatgccctggaggaagtgctcagcaaagccctgagtcagcgcacgatcactgtcggggtgtacgaagcggccaagctgctcaacgtcgaccccgataacgtggtgttgtgcctgctggcggcggacgaggacgacgacagagatgtggctctgcagatccacttcaccctgatccaggcgttttgctgcgagaacgacatcaacatcctgcgcgtcagcaacccgggccggctggcggagctcctgctcttggagaccgacgctggccccgcggcgagcgagggcgccgagcagcccccggacctgcactgcgtgctggtgacgaatccacattcatctcaatggaaggatcctgccttaagtcaacttatttgtttttgccgggaaagtcgctacatggatcaatgggttccagtgattaatctccctgaacggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 2, regulatory, cardiac, slow - family with sequence similarity 163, member A - BCL2/adenovirus E1B 19kDa interacting protein 3 - N-acetyltransferase 14 (GCN5-related, putative) |