UXT-ubiquitously-expressed transcript Gene View larger

UXT-ubiquitously-expressed transcript Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UXT-ubiquitously-expressed transcript Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UXT-ubiquitously-expressed transcript Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000720
Product type: DNA & cDNA
Ncbi symbol: UXT
Origin species: Human
Product name: UXT-ubiquitously-expressed transcript Gene
Size: 2ug
Accessions: BC000720
Gene id: 8409
Gene description: ubiquitously-expressed transcript
Synonyms: protein UXT; ART-27; STAP1; SKP2-associated alpha PFD 1; androgen receptor trapped clone 27 protein; ubiquitously expressed transcript protein; ubiquitously expressed prefoldin like chaperone
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgccccctaagcggcgggcggtggaggccacgggggagaaagtgctgcgctacgagaccttcatcagtgacgtgctgcagcgggacttgcgaaaggtgctggaccatcgagacaaggtatatgagcagctggccaaataccttcaactgagaaatgtcattgagcgactccaggaagctaagcactcggagttatatatgcaggtggatttgggctgtaacttcttcgttgacacagtggtcccagatacttcacgcatctatgtggccctgggatatggttttttcctggagttgacactggcagaagctctcaagttcattgatcgtaagagctctctcctcacagagctcagcaacagcctcaccaaggactccatgaatatcaaagcccatatccacatgttgctagaggggcttagagaactacaaggcctgcagaatttcccagagaagcctcaccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - slingshot homolog 2 (Drosophila)
- ubiquitin specific peptidase 53
- tripartite motif family-like 1
- protein O-fucosyltransferase 1

Buy UXT-ubiquitously-expressed transcript Gene now

Add to cart