Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UXT-ubiquitously-expressed transcript Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UXT-ubiquitously-expressed transcript Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000720 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UXT |
| Origin species: | Human |
| Product name: | UXT-ubiquitously-expressed transcript Gene |
| Size: | 2ug |
| Accessions: | BC000720 |
| Gene id: | 8409 |
| Gene description: | ubiquitously-expressed transcript |
| Synonyms: | protein UXT; ART-27; STAP1; SKP2-associated alpha PFD 1; androgen receptor trapped clone 27 protein; ubiquitously expressed transcript protein; ubiquitously expressed prefoldin like chaperone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgacgccccctaagcggcgggcggtggaggccacgggggagaaagtgctgcgctacgagaccttcatcagtgacgtgctgcagcgggacttgcgaaaggtgctggaccatcgagacaaggtatatgagcagctggccaaataccttcaactgagaaatgtcattgagcgactccaggaagctaagcactcggagttatatatgcaggtggatttgggctgtaacttcttcgttgacacagtggtcccagatacttcacgcatctatgtggccctgggatatggttttttcctggagttgacactggcagaagctctcaagttcattgatcgtaagagctctctcctcacagagctcagcaacagcctcaccaaggactccatgaatatcaaagcccatatccacatgttgctagaggggcttagagaactacaaggcctgcagaatttcccagagaagcctcaccattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - slingshot homolog 2 (Drosophila) - ubiquitin specific peptidase 53 - tripartite motif family-like 1 - protein O-fucosyltransferase 1 |