Login to display prices
Login to display prices
UXT-ubiquitously-expressed transcript Gene View larger

UXT-ubiquitously-expressed transcript Gene

PTXBC000720

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UXT-ubiquitously-expressed transcript Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UXT-ubiquitously-expressed transcript Gene

Proteogenix catalog: PTXBC000720
Ncbi symbol: UXT
Product name: UXT-ubiquitously-expressed transcript Gene
Size: 2ug
Accessions: BC000720
Gene id: 8409
Gene description: ubiquitously-expressed transcript
Synonyms: protein UXT; ART-27; STAP1; SKP2-associated alpha PFD 1; androgen receptor trapped clone 27 protein; ubiquitously expressed transcript protein; ubiquitously expressed prefoldin like chaperone
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgccccctaagcggcgggcggtggaggccacgggggagaaagtgctgcgctacgagaccttcatcagtgacgtgctgcagcgggacttgcgaaaggtgctggaccatcgagacaaggtatatgagcagctggccaaataccttcaactgagaaatgtcattgagcgactccaggaagctaagcactcggagttatatatgcaggtggatttgggctgtaacttcttcgttgacacagtggtcccagatacttcacgcatctatgtggccctgggatatggttttttcctggagttgacactggcagaagctctcaagttcattgatcgtaagagctctctcctcacagagctcagcaacagcctcaccaaggactccatgaatatcaaagcccatatccacatgttgctagaggggcttagagaactacaaggcctgcagaatttcccagagaagcctcaccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: