Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene
PTXBC017423
New product
Data sheet of MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017423 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MIER1 |
| Origin species: | Human |
| Product name: | MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC017423 |
| Gene id: | 57708 |
| Gene description: | mesoderm induction early response 1 homolog (Xenopus laevis) |
| Synonyms: | MIER1 transcriptional regulator; MI-ER1; mesoderm induction early response protein 1; mesoderm induction early response 1 homolog; mesoderm induction early response 1, transcriptional regulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggaaggagaaacaaacttcagctctgaaatagaagatcttgcaagggaaggcgacatgccaattcatgaacttctcagcctttatggttatggtagtactgttcgactacctgaagaagatgaggaagaggaagaagaggaagaagaaggtgaagatgatgaagatgctgataatgatgacaacagtggctgtagtggggaaaataaagaggagaatataaaggattcatcaggtcaggaggatgaaactcagtcttccaatgatgatccatcacaatctgttgcttctcaagatgcccaggaaataatccgcccacgtcgatgtaaatattttgatacaaatagtgaagtagaagaagaatctgaagaagatgaagattatattccatcagaagactggaaaaaggagattatggtgggctccatgtttcaagcagaaattccagttggcatttgtagatactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa - COX11 homolog, cytochrome c oxidase assembly protein (yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 - poliovirus receptor-related 2 (herpesvirus entry mediator B) |