Login to display prices
Login to display prices
MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene View larger

MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017423
Product type: DNA & cDNA
Ncbi symbol: MIER1
Origin species: Human
Product name: MIER1-mesoderm induction early response 1 homolog (Xenopus laevis) Gene
Size: 2ug
Accessions: BC017423
Gene id: 57708
Gene description: mesoderm induction early response 1 homolog (Xenopus laevis)
Synonyms: MIER1 transcriptional regulator; MI-ER1; mesoderm induction early response protein 1; mesoderm induction early response 1 homolog; mesoderm induction early response 1, transcriptional regulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggaaggagaaacaaacttcagctctgaaatagaagatcttgcaagggaaggcgacatgccaattcatgaacttctcagcctttatggttatggtagtactgttcgactacctgaagaagatgaggaagaggaagaagaggaagaagaaggtgaagatgatgaagatgctgataatgatgacaacagtggctgtagtggggaaaataaagaggagaatataaaggattcatcaggtcaggaggatgaaactcagtcttccaatgatgatccatcacaatctgttgcttctcaagatgcccaggaaataatccgcccacgtcgatgtaaatattttgatacaaatagtgaagtagaagaagaatctgaagaagatgaagattatattccatcagaagactggaaaaaggagattatggtgggctccatgtttcaagcagaaattccagttggcatttgtagatactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
- COX11 homolog, cytochrome c oxidase assembly protein (yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
- poliovirus receptor-related 2 (herpesvirus entry mediator B)