Login to display prices
Login to display prices
PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene View larger

PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene

PTXBC019062

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene

Proteogenix catalog: PTXBC019062
Ncbi symbol: PSMD12
Product name: PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene
Size: 2ug
Accessions: BC019062
Gene id: 5718
Gene description: proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms: Rpn5; p55; 26S proteasome non-ATPase regulatory subunit 12; 26S proteasome regulatory subunit RPN5; 26S proteasome regulatory subunit p55; proteasome (prosome, macropain) 26S subunit, non-ATPase, 12; proteasome 26S subunit, non-ATPase 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacggcggctcggagcgggctgacgggcgcatcgtcaagatggaggtggactacagcgccacggtggatcagcgcctacccgagtgtgcgaagctagccaaggaaggaagacttcaagaagtcattgaaacccttctctctctggaaaagcagactcgtactgcttccgatatggtatcgacatcccgtatcttagttgcagtagtgaagatgtgctatgaggctaaagaatgggatttacttaatgaaaatattatgcttttgtccaaaaggcggagtcagttaaaacaagctgttgccaaaatggttcaacagtgctgtacttatgttgaggaaatcacagaccttcctatcaaacttcgattaattgatactctacgaatggttaccgaaggcaagatttatgttgaaattgagcgtgcgcgactgactaaaacattagcaactataaaagaacaaaatggtgatgtgaaagaggcagcctccattttacaggagttacaggtggaaacctacgggtcaatggaaaagaaagagcgagtggaatttattttggagcaaatgaggctctgcctagctgtgaaggattacattcgaacacaaatcatcagcaagaaaattaacaccaaatttttccaggaagaaaatacagagaaattaaagttgaagtactataatttaatgattcagctggatcaacatgagggatcctatttgtctatttgtaagcactacagagcaatatatgatactccctgtatacaggcagaaagtgaaaaatggcagcaggctctgaagagtgttgtactctatgttatcctggctccttttgacaatgaacagtcagatttggttcaccgaataagtggtgacaagaagttagaagaaattcccaaatacaaggatcttttaaagctttttaccacaatggagttgatgcgttggtccacacttgttgaggactatggaatggaattaagaaaaggttcccttgagagtcctgcaacggatgtttttggttctacagaggaaggtgaaaaaaggtggaaagacttgaagaacagagttgttgaacataatattagaataatggccaagtattatactcggataacaatgaaaaggatggcacagcttctggatctatctgttgatgagtccgaagcctttctctcaaatctagtagttaacaagaccatctttgctaaagtagacagattagcaggaattatcaacttccagagacccaaggatccaaataatttattaaatgactggtctcagaaactgaactcattaatgtctctggttaacaaaactacgcatctcatagccaaagaggagatgatacataatctacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: