PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene View larger

PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene

PTXBC019062

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019062
Product type: DNA & cDNA
Ncbi symbol: PSMD12
Origin species: Human
Product name: PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene
Size: 2ug
Accessions: BC019062
Gene id: 5718
Gene description: proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms: Rpn5; p55; 26S proteasome non-ATPase regulatory subunit 12; 26S proteasome regulatory subunit RPN5; 26S proteasome regulatory subunit p55; proteasome (prosome, macropain) 26S subunit, non-ATPase, 12; proteasome 26S subunit, non-ATPase 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacggcggctcggagcgggctgacgggcgcatcgtcaagatggaggtggactacagcgccacggtggatcagcgcctacccgagtgtgcgaagctagccaaggaaggaagacttcaagaagtcattgaaacccttctctctctggaaaagcagactcgtactgcttccgatatggtatcgacatcccgtatcttagttgcagtagtgaagatgtgctatgaggctaaagaatgggatttacttaatgaaaatattatgcttttgtccaaaaggcggagtcagttaaaacaagctgttgccaaaatggttcaacagtgctgtacttatgttgaggaaatcacagaccttcctatcaaacttcgattaattgatactctacgaatggttaccgaaggcaagatttatgttgaaattgagcgtgcgcgactgactaaaacattagcaactataaaagaacaaaatggtgatgtgaaagaggcagcctccattttacaggagttacaggtggaaacctacgggtcaatggaaaagaaagagcgagtggaatttattttggagcaaatgaggctctgcctagctgtgaaggattacattcgaacacaaatcatcagcaagaaaattaacaccaaatttttccaggaagaaaatacagagaaattaaagttgaagtactataatttaatgattcagctggatcaacatgagggatcctatttgtctatttgtaagcactacagagcaatatatgatactccctgtatacaggcagaaagtgaaaaatggcagcaggctctgaagagtgttgtactctatgttatcctggctccttttgacaatgaacagtcagatttggttcaccgaataagtggtgacaagaagttagaagaaattcccaaatacaaggatcttttaaagctttttaccacaatggagttgatgcgttggtccacacttgttgaggactatggaatggaattaagaaaaggttcccttgagagtcctgcaacggatgtttttggttctacagaggaaggtgaaaaaaggtggaaagacttgaagaacagagttgttgaacataatattagaataatggccaagtattatactcggataacaatgaaaaggatggcacagcttctggatctatctgttgatgagtccgaagcctttctctcaaatctagtagttaacaagaccatctttgctaaagtagacagattagcaggaattatcaacttccagagacccaaggatccaaataatttattaaatgactggtctcagaaactgaactcattaatgtctctggttaacaaaactacgcatctcatagccaaagaggagatgatacataatctacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poliovirus receptor-related 2 (herpesvirus entry mediator B)
- succinate dehydrogenase complex, subunit A, flavoprotein (Fp)
- protein phosphatase 1, regulatory (inhibitor) subunit 15A
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa

Buy PSMD12-proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene now

Add to cart