Login to display prices
Login to display prices
PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene View larger

PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003091
Product type: DNA & cDNA
Ncbi symbol: PVRL2
Origin species: Human
Product name: PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene
Size: 2ug
Accessions: BC003091
Gene id: 5819
Gene description: poliovirus receptor-related 2 (herpesvirus entry mediator B)
Synonyms: PVRL2; CD112; HVEB; PRR2; PVRR2; nectin-2; herpesvirus entry protein B; poliovirus receptor-like 2; poliovirus receptor-related 2 (herpesvirus entry mediator B); nectin cell adhesion molecule 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgggccgctgccctcctgccgtcgagatcgccgccgacgccgctgctgtggccgctgctgctgctgctgctcctggaaaccggagcccaggatgtgcgagttcaagtgctacccgaggtgcgaggccagctcgggggcaccgtggagctgccgtgccacctgctgccacctgttcctggactgtacatctccctggtgacctggcagcgcccagatgcacctgcgaaccaccagaatgtggccgccttccaccctaagatgggtcccagcttccccagcccgaagcctggcagcgagcggctgtccttcgtctctgccaagcagagcactgggcaagacacagaggcagagctccaggacgccacgctggccctccacgggctcacggtggaggacgagggcaactacacttgcgagtttgccaccttccccaaggggtccgtccgagggatgacctggctcagagtcatagccaagcccaagaaccaagctgaggcccagaaggtcacgttcagccaggaccctacgacagtggccctctgcatctccaaagagggccgcccacctgcccggatctcctggctctcatccctggactgggaagccaaagagactcaggtgtcagggaccctggccggaactgtcactgtcaccagccgcttcaccttggtgccctcgggccgagcagatggtgtcacggtcacctgcaaagtggagcatgagagcttcgaggaaccagccctgatacctgtgaccctctctgtacgctaccctcctgaagtgtccatctccggctatgatgacaactggtacctcggccgtactgatgccaccctgagctgtgacgtccgcagcaacccagagcccacgggctatgactggagcacgacctcaggcaccttcccgacctccgcagtggcccagggctcccagctggtcatccacgcagtggacagtctgttcaataccaccttcgtctgcacagtcaccaatgccgtgggcatgggccgcgctgagcaggtcatctttgtccgagaaacccccagggcctcgccccgagatgtgggcccgctggtgtggggggccgtgggggggacactgctggtgctgctgcttctggctggggggtccttggccttcatcctgctgagggtgaggaggaggaggaagagccctggaggagcaggaggaggagccagtggcgacgggggattctacgatccgaaagctcaggtgttgggaaatggggaccccgtcttctggacaccagtagtccctggtcccatggaaccagatggcaaggatgaggaggaggaggaggaggaagagaaggcagagaaaggcctcatgttgcctccacccccagcactcgaggatgacatggagtcccagctggacggctccctcatctcacggcgggcagtttatgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - succinate dehydrogenase complex, subunit A, flavoprotein (Fp)
- protein phosphatase 1, regulatory (inhibitor) subunit 15A
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
- SEC22 vesicle trafficking protein homolog B (S. cerevisiae)