Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene
PTXBC003091
New product
Data sheet of PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003091 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PVRL2 |
| Origin species: | Human |
| Product name: | PVRL2-poliovirus receptor-related 2 (herpesvirus entry mediator B) Gene |
| Size: | 2ug |
| Accessions: | BC003091 |
| Gene id: | 5819 |
| Gene description: | poliovirus receptor-related 2 (herpesvirus entry mediator B) |
| Synonyms: | PVRL2; CD112; HVEB; PRR2; PVRR2; nectin-2; herpesvirus entry protein B; poliovirus receptor-like 2; poliovirus receptor-related 2 (herpesvirus entry mediator B); nectin cell adhesion molecule 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgggccgctgccctcctgccgtcgagatcgccgccgacgccgctgctgtggccgctgctgctgctgctgctcctggaaaccggagcccaggatgtgcgagttcaagtgctacccgaggtgcgaggccagctcgggggcaccgtggagctgccgtgccacctgctgccacctgttcctggactgtacatctccctggtgacctggcagcgcccagatgcacctgcgaaccaccagaatgtggccgccttccaccctaagatgggtcccagcttccccagcccgaagcctggcagcgagcggctgtccttcgtctctgccaagcagagcactgggcaagacacagaggcagagctccaggacgccacgctggccctccacgggctcacggtggaggacgagggcaactacacttgcgagtttgccaccttccccaaggggtccgtccgagggatgacctggctcagagtcatagccaagcccaagaaccaagctgaggcccagaaggtcacgttcagccaggaccctacgacagtggccctctgcatctccaaagagggccgcccacctgcccggatctcctggctctcatccctggactgggaagccaaagagactcaggtgtcagggaccctggccggaactgtcactgtcaccagccgcttcaccttggtgccctcgggccgagcagatggtgtcacggtcacctgcaaagtggagcatgagagcttcgaggaaccagccctgatacctgtgaccctctctgtacgctaccctcctgaagtgtccatctccggctatgatgacaactggtacctcggccgtactgatgccaccctgagctgtgacgtccgcagcaacccagagcccacgggctatgactggagcacgacctcaggcaccttcccgacctccgcagtggcccagggctcccagctggtcatccacgcagtggacagtctgttcaataccaccttcgtctgcacagtcaccaatgccgtgggcatgggccgcgctgagcaggtcatctttgtccgagaaacccccagggcctcgccccgagatgtgggcccgctggtgtggggggccgtgggggggacactgctggtgctgctgcttctggctggggggtccttggccttcatcctgctgagggtgaggaggaggaggaagagccctggaggagcaggaggaggagccagtggcgacgggggattctacgatccgaaagctcaggtgttgggaaatggggaccccgtcttctggacaccagtagtccctggtcccatggaaccagatggcaaggatgaggaggaggaggaggaggaagagaaggcagagaaaggcctcatgttgcctccacccccagcactcgaggatgacatggagtcccagctggacggctccctcatctcacggcgggcagtttatgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - succinate dehydrogenase complex, subunit A, flavoprotein (Fp) - protein phosphatase 1, regulatory (inhibitor) subunit 15A - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa - SEC22 vesicle trafficking protein homolog B (S. cerevisiae) |