Login to display prices
Login to display prices
NDUFB8-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa Gene View larger

NDUFB8-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa Gene

PTXBC000466

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB8-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB8-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa Gene

Proteogenix catalog: PTXBC000466
Ncbi symbol: NDUFB8
Product name: NDUFB8-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa Gene
Size: 2ug
Accessions: BC000466
Gene id: 4714
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
Synonyms: ASHI; CI-ASHI; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, mitochondrial; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa; NADH:ubiquinone oxidoreductase ASHI subunit; complex I ASHI subunit; complex I-ASHI; NADH:ubiquinone oxidoreductase subunit B8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtggccagggccggggtcttgggagtccagtggctgcaaagggcatcccggaacgtgatgccgctgggcgcacggacagcctcccacatgaccaaggacatgttcccggggccctatcctaggaccccagaagaacgggccgccgccgccaagaagtataatatgcgtgtggaagactacgaaccttacccggatgatggcatggggtatggcgactacccgaagctccctgaccgctcacagcatgagagagatccatggtatagctgggaccagccgggcctgaggttgaactggggtgaaccgatgcactggcacctagacatgtacaacaggaaccgtgtggatacatcccccacacctgtttcttggcatgtcatgtgtatgcagctcttcggtttcctggctttcatgatattcatgtgctgggtgggggacgtgtaccctgtctaccagcctgtgggaccaaagcagtatccttacaataatctgtacctggaacgaggcggtgatccctccaaagaaccagagcgggtggttcactatgagatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: