COX11-COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene View larger

COX11-COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene

PTXBC005895

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX11-COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX11-COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005895
Product type: DNA & cDNA
Ncbi symbol: COX11
Origin species: Human
Product name: COX11-COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene
Size: 2ug
Accessions: BC005895
Gene id: 1353
Gene description: COX11 homolog, cytochrome c oxidase assembly protein (yeast)
Synonyms: COX11, cytochrome c oxidase copper chaperone; COX11 homolog, cytochrome c oxidase assembly protein; cytochrome c oxidase assembly protein COX11, mitochondrial; COX11P; cytochrome c oxidase subunit 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagggctctggcgtcctggatggaggtgcgttcctttctgtggctggcgctggatccaccctgggtctccaaccagggctgcagagagggtagagccgtttcttaggccagagtggagtgggacaggaggtgccgagagaggactgaggtggcttgggacatggaagcgctgcagccttcgagcccggcatccagcattgcagccgccgcggcggcctaagagctcgaaccctttcacacgcgcgcaggaggaggagcggcggcggcagaacaagacgaccctcacttacgtggccgctgtcgccgtgggcatgctgggggcgtcctacgctgccgtacccctttatcggctctattgccagactactggacttggaggatcagcagttgcaggtcatgcctcagacaagattgaaaacatggtgcctgttaaagatcgaatcattaaaattagctttaatgcagatgtgcatgcaagtctccagtggaactttagacctcagcaaacagaaatatatgtggtgccaggagagactgcactggcgttttacagagttaagaatcctactgacaaaccagtaattggaatttctacatacaatattgttccatttgaagctggacagtatttcaataaaatacagtgcttctgttttgaagaacaaaggcttaatccccaagaggaagtagatatgccagtgtttttctacattgatcctgaatttgctgaagatccaagaatgattaaagttgatcttatcactctttcttacactttttttgaagcaaaggaagggcacaagttgccagttccaggatataattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
- poliovirus receptor-related 2 (herpesvirus entry mediator B)
- succinate dehydrogenase complex, subunit A, flavoprotein (Fp)
- protein phosphatase 1, regulatory (inhibitor) subunit 15A

Buy COX11-COX11 homolog, cytochrome c oxidase assembly protein (yeast) Gene now

Add to cart