LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene View larger

LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001767
Product type: DNA & cDNA
Ncbi symbol: LSM1
Origin species: Human
Product name: LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001767
Gene id: 27257
Gene description: LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Synonyms: LSM1 homolog, mRNA degradation associated; LSM1-like protein U6 small nuclear RNA associated; LSM1, U6 small nuclear RNA associated; LSM1 mRNA degradation associated; LSM1 homolog, U6 small nuclear RNA associated; U6 snRNA-associated Sm-like protein LSm1; CASM; YJL124C; cancer‐associated Sm protein; cancer-associated Sm protein; cancer-associated Sm-like protein; small nuclear ribonuclear CaSm
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactatatgcctggcaccgccagcctcatcgaggacattgacaaaaagcacttggttctgcttcgagatggaaggacacttataggctttttaagaagcattgatcaatttgcaaacttagtgctacatcagactgtggagcgtattcatgtgggcaaaaaatacggtgatattcctcgagggatttttgtggtcagaggagaaaatgtggtcctactaggagaaatagacttggaaaaggagagtgacacacccctccagcaagtatccattgaagaaattctagaagaacaaagggtggaacagcagaccaagctggaagcagagaagttgaaagtgcaggccctgaaggaccgaggtctttccattcctcgagcagatactcttgatgagtactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mesoderm induction early response 1 homolog (Xenopus laevis)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
- COX11 homolog, cytochrome c oxidase assembly protein (yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

Buy LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene now

Add to cart