Login to display prices
Login to display prices
SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene View larger

SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene

PTXBC001381

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene

Proteogenix catalog: PTXBC001381
Ncbi symbol: SNRNP25
Product name: SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene
Size: 2ug
Accessions: BC001381
Gene id: 79622
Gene description: small nuclear ribonucleoprotein 25kDa (U11/U12)
Synonyms: C16orf33; U11/U12 small nuclear ribonucleoprotein 25 kDa protein; U11/U12 snRNP 25 kDa protein; U11/U12 snRNP 25K; minus-99 protein; small nuclear ribonucleoprotein 25kDa (U11/U12); small nuclear ribonucleoprotein, U11/U12 25kDa subunit; small nuclear ribonucleoprotein U11/U12 subunit 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgtgttccaggagggtctggctatggtggtgcaggacccgctgctctgcgatctgccgatccaggttactctggaagaagtcaactcccaaatagccctagaatacggccaggcaatgacggtccgagtgtgcaagatggatggagaagtaatgcccgtggttgtagtgcagagtgccacagtcctggacctgaagaaggccatccagagatacgtgcagctcaagcaggagcgtgaagggggcattcagcacatcagctggtcctacgtgtggaggacgtaccatctgacctctgcaggagagaaactcacggaagacagaaagaagctccgagactacggcatccggaatcgagacgaggtttccttcatcaaaaagctgaggcaaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: