Login to display prices
Login to display prices
RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene View larger

RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene

PTXBC014131

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene

Proteogenix catalog: PTXBC014131
Ncbi symbol: RPUSD4
Product name: RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene
Size: 2ug
Accessions: BC014131
Gene id: 84881
Gene description: RNA pseudouridylate synthase domain containing 4
Synonyms: RNA pseudouridylate synthase domain-containing protein 4; RNA pseudouridylate synthase domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccaggtggagcgcgtcgggcccctggatccggggaaacggccaaggttgcgggagtctcttcactctcgtctcaaagccattttgtgccgctgccgctgcctctacggccataaatgcccagagattagcggagaagctccgagcccagaaacgggaacaagacacaaagaaggagccggtgtccacaaacgctgttcagcggagagtgcaagaaatagtgcggttcacacggcagctgcagcgagtccaccccaacgtgcttgctaaggcactgacccgaggaattctccaccaggacaagaaccttgtggtcatcaataagccctacggtctccctgtgcatggtggccctggggtccagctctgcatcactgatgtactacctatcctggcaaagatgcttcatggccacaaggcagagcccttgcatctgtgccaccggctggacaaggaaaccacaggtgtaatggtgttggcttgggacaaggacatggcacatcaagtccaagagttgtttagaacccgtcaggtggtgaagaagtactgggccatcactgtgcatgtccccatgccctcagcaggagtcgtggacatccccattgtggagaaggaggcgcaaggccagcagcaacaccacaagatgacattgtccccgagctaccgcatggacgatgggaaaatggtgaaagtgcggcgcagccggaatgcgcaagttgctgtaactcagtaccaggtgctcagcagcactctctcctccgccctcgtggagctccagcccatcactggaataaaacatcagcttcgagttcacttgtcttttggattggattgtccaatccttggtgatcacaagtactcagactggaataggttggccccccagaagctgtctgtgggcaccctgaagaagctggggctagaacagtcgaaggcccgctacatcccccttcacctgcacgcccggcagctgatcctgcctgccctggggtccgggaaggaggaactcaacttggtctgcaaacttcctcgcttctttgtgcattccctgcaccgcctgcgtttagagatgccaaatgaggatcaaaatgagaacaatgaagccaagtgtctgggagcacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: