RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene View larger

RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014131
Product type: DNA & cDNA
Ncbi symbol: RPUSD4
Origin species: Human
Product name: RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene
Size: 2ug
Accessions: BC014131
Gene id: 84881
Gene description: RNA pseudouridylate synthase domain containing 4
Synonyms: RNA pseudouridylate synthase domain-containing protein 4; RNA pseudouridylate synthase domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccaggtggagcgcgtcgggcccctggatccggggaaacggccaaggttgcgggagtctcttcactctcgtctcaaagccattttgtgccgctgccgctgcctctacggccataaatgcccagagattagcggagaagctccgagcccagaaacgggaacaagacacaaagaaggagccggtgtccacaaacgctgttcagcggagagtgcaagaaatagtgcggttcacacggcagctgcagcgagtccaccccaacgtgcttgctaaggcactgacccgaggaattctccaccaggacaagaaccttgtggtcatcaataagccctacggtctccctgtgcatggtggccctggggtccagctctgcatcactgatgtactacctatcctggcaaagatgcttcatggccacaaggcagagcccttgcatctgtgccaccggctggacaaggaaaccacaggtgtaatggtgttggcttgggacaaggacatggcacatcaagtccaagagttgtttagaacccgtcaggtggtgaagaagtactgggccatcactgtgcatgtccccatgccctcagcaggagtcgtggacatccccattgtggagaaggaggcgcaaggccagcagcaacaccacaagatgacattgtccccgagctaccgcatggacgatgggaaaatggtgaaagtgcggcgcagccggaatgcgcaagttgctgtaactcagtaccaggtgctcagcagcactctctcctccgccctcgtggagctccagcccatcactggaataaaacatcagcttcgagttcacttgtcttttggattggattgtccaatccttggtgatcacaagtactcagactggaataggttggccccccagaagctgtctgtgggcaccctgaagaagctggggctagaacagtcgaaggcccgctacatcccccttcacctgcacgcccggcagctgatcctgcctgccctggggtccgggaaggaggaactcaacttggtctgcaaacttcctcgcttctttgtgcattccctgcaccgcctgcgtttagagatgccaaatgaggatcaaaatgagaacaatgaagccaagtgtctgggagcacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ER degradation enhancer, mannosidase alpha-like 2
- WW domain containing E3 ubiquitin protein ligase 1
- adaptor-related protein complex 2, beta 1 subunit
- DIS3 mitotic control homolog (S. cerevisiae)-like

Buy RPUSD4-RNA pseudouridylate synthase domain containing 4 Gene now

Add to cart