Login to display prices
Login to display prices
FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene View larger

FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene

PTXBC010074

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene

Proteogenix catalog: PTXBC010074
Ncbi symbol: FUSIP1
Product name: FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
Size: 2ug
Accessions: BC010074
Gene id: 10772
Gene description: FUS interacting protein (serine/arginine-rich) 1
Synonyms: FUSIP1; FUSIP2; NSSR; PPP1R149; SFRS13; SFRS13A; SRp38; SRrp40; TASR; TASR1; TASR2; serine/arginine-rich splicing factor 10; 40 kDa SR-repressor protein; FUS interacting protein (serine-arginine rich) 1; FUS-interacting protein (serine-arginine rich) 2; SR splicing factor 10; TLS-associated SR protein; TLS-associated protein TASR; TLS-associated protein with SR repeats; TLS-associated protein with Ser-Arg repeats; TLS-associated serine-arginine protein 1; TLS-associated serine-arginine protein 2; neural-salient SR protein; protein phosphatase 1, regulatory subunit 149; serine-arginine repressor protein (40 kDa); splicing factor SRp38; splicing factor, arginine/serine-rich 13; splicing factor, arginine/serine-rich 13A; serine and arginine rich splicing factor 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccgctacctgcgtccccccaacacgtctctgttcgtcaggaacgtggccgacgacaccaggtctgaagacttgcggcgtgaatttggtcgttatggtcctatagttgatgtgtatgttccacttgatttctacactcgccgtccaagaggatttgcttatgttcaatttgaggatgttcgtgatgctgaagacgctttacataatttggacagaaagtggatttgtggacggcagattgaaatacagtttgcccagggggatcgaaagacaccaaatcagatgaaagccaaggaagggaggaatgtgtacagttcttcacgctatgatgattatgacagatacagacgttctagaagccgaagttatgaaaggaggagatcaagaagtcggtcttttgattacaactatagaagatcgtatagtcctagaaacagtagaccgactggaagaccacggcgtagcagaagccattccgacaatgatagccaagtaagcaagaagaaaaatgagagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: