Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
PTXBC005039
New product
Data sheet of FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005039 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FUSIP1 |
| Origin species: | Human |
| Product name: | FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene |
| Size: | 2ug |
| Accessions: | BC005039 |
| Gene id: | 10772 |
| Gene description: | FUS interacting protein (serine/arginine-rich) 1 |
| Synonyms: | FUSIP1; FUSIP2; NSSR; PPP1R149; SFRS13; SFRS13A; SRp38; SRrp40; TASR; TASR1; TASR2; serine/arginine-rich splicing factor 10; 40 kDa SR-repressor protein; FUS interacting protein (serine-arginine rich) 1; FUS-interacting protein (serine-arginine rich) 2; SR splicing factor 10; TLS-associated SR protein; TLS-associated protein TASR; TLS-associated protein with SR repeats; TLS-associated protein with Ser-Arg repeats; TLS-associated serine-arginine protein 1; TLS-associated serine-arginine protein 2; neural-salient SR protein; protein phosphatase 1, regulatory subunit 149; serine-arginine repressor protein (40 kDa); splicing factor SRp38; splicing factor, arginine/serine-rich 13; splicing factor, arginine/serine-rich 13A; serine and arginine rich splicing factor 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccgctacctgcgtccccccaacacgtctctgttcgtcaggaacgtggccgacgacaccaggtctgaagacttgcggcgtgaatttggtcgttatggtcctatagttgatgtgtatgttccacttgatttctacactcgccgtccaagaggatttgcttatgttcaatttgaggatgttcgtgatgctgaagacgctttacataatttggacagaaagtggatttgtggacggcagattgaaatacagtttgcccagggggatcgaaagacaccaaatcagatgaaagccaaggaagggaggaatgtgtacagttcttcacgctatgatgattatgacagatacagacgttctagaagccgaagttatgaaaggaggagatcaagaagtcggtcttttgattacaactatagaagatcgtatagtcctagaaacagtagaccgactggaagaccacggcgtagcagaagccattccgacaatgatagattcaaacaccgaaatcgatctttttcaagatctaaatccaattcaagatcacggtccaagtcccagcccaagaaagaaatgaaggctaaatcacgttctaggtctgcatctcacaccaaaactagaggcacctctaaaacagattccaaaacacattataagtctggctcaagatatgaaaaggaatcaaggaaaaaagaaccacctagatccaaatctcagtcaagatcacagtctaggtctaggtcaaaatctagatcaaggtcttggactagtcctaagtccagtggccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA pseudouridylate synthase domain containing 4 - ER degradation enhancer, mannosidase alpha-like 2 - WW domain containing E3 ubiquitin protein ligase 1 - adaptor-related protein complex 2, beta 1 subunit |