Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2D-polymerase (RNA) II (DNA directed) polypeptide D Gene
PTXBC017205
New product
Data sheet of POLR2D-polymerase (RNA) II (DNA directed) polypeptide D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2D-polymerase (RNA) II (DNA directed) polypeptide D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017205 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2D |
| Origin species: | Human |
| Product name: | POLR2D-polymerase (RNA) II (DNA directed) polypeptide D Gene |
| Size: | 2ug |
| Accessions: | BC017205 |
| Gene id: | 5433 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide D |
| Synonyms: | HSRBP4; HSRPB4; RBP4; RPB16; DNA-directed RNA polymerase II subunit RPB4; DNA-directed RNA polymerase II 16 kDa polypeptide; DNA-directed RNA polymerase II subunit D; RNA polymerase II 16 kDa subunit; RNA polymerase II subunit B4; RNA polymerase II subunit hsRBP4; polymerase (RNA) II (DNA directed) polypeptide D; polymerase (RNA) II subunit D; RNA polymerase II subunit D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgggtggcagcgatccgcgggctggcgacgtagaggaggacgcctcacagctcatctttcctaaagagtttgaaacagctgagacacttctaaattcagaagttcatatgcttctggaacatcgaaagcagcagaatgagagtgcagaggacgaacaggagctctcagaagtcttcatgaaaacattaaactacacagcccgtttcagtcgtttcaaaaacagagagaccattgccagtgttcgtagcttgctactccagaaaaagcttcataagtttgagttggcctgtttggccaacctttgcccagagactgctgaggagtccaaggctctaatcccaagcttggagggacggtttgaagatgaggagctgcagcagattcttgatgatatccagacaaagcgcagctttcagtattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FUS interacting protein (serine/arginine-rich) 1 - FUS interacting protein (serine/arginine-rich) 1 - RNA pseudouridylate synthase domain containing 4 - ER degradation enhancer, mannosidase alpha-like 2 |