PCNP-PEST proteolytic signal containing nuclear protein Gene View larger

PCNP-PEST proteolytic signal containing nuclear protein Gene

PTXBC013916

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCNP-PEST proteolytic signal containing nuclear protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCNP-PEST proteolytic signal containing nuclear protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013916
Product type: DNA & cDNA
Ncbi symbol: PCNP
Origin species: Human
Product name: PCNP-PEST proteolytic signal containing nuclear protein Gene
Size: 2ug
Accessions: BC013916
Gene id: 57092
Gene description: PEST proteolytic signal containing nuclear protein
Synonyms: PEST proteolytic signal-containing nuclear protein; PEST-containing nuclear protein; PEST proteolytic signal containing nuclear protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacgggaaggcgggagacgagaagcctgaaaagtcgcagcgagctggagccgccggaggacctgaagaagaagcagaaaaacctgtgaaaactaagactgtttcttccagtaatggaggggaaagttccagtcgcagcgctgagaagcgatcagctgaagaagaagctgccgacctcccaacaaagcctacaaagatctccaagtttggatttgccataggtagtcagacgacaaagaaagcatcagccatatccatcaaacttggatcaagtaagcctaaagaaactgttccaactcttgctccaaaaactctttcagtagcagcagcttttaatgaagatgaagatggatacaccaacatcagctggaccaaactccttcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small nuclear ribonucleoprotein 25kDa (U11/U12)
- polymerase (RNA) II (DNA directed) polypeptide D
- FUS interacting protein (serine/arginine-rich) 1
- FUS interacting protein (serine/arginine-rich) 1

Buy PCNP-PEST proteolytic signal containing nuclear protein Gene now

Add to cart