NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene View larger

NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009801
Product type: DNA & cDNA
Ncbi symbol: NDUFB6
Origin species: Human
Product name: NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene
Size: 2ug
Accessions: BC009801
Gene id: 4712
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa
Synonyms: B17; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 6; CI-B17; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa; NADH-ubiquinone oxidoreductase B17 subunit; NADH-ubiquinone oxidoreductase beta subunit, 6; complex I, mitochondrial respiratory chain, B17 subunit; complex I-B17; NADH:ubiquinone oxidoreductase subunit B6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggggtacactccggatgagaaactgcggctgcagcagctgcgagagctgagaaggcgatggctgaaggaccaggagctgagccctcgggagccggtgctgcccccacagaagatggggcctatggagaaattctggaataaatttttggagaataaatccccttggaggaaaatggtccatggggtatacaaaaagagtatctttgttttcactcatgtacttgtacctgtctggattattcattattacatgaagtatcatgtttctgaaaaaccatatggcatagttgaaaagaagtccagaatattccctggtgatacaattctggagactggagaagtaattccaccaatgaaagaatttcctgatcaacatcattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- mesoderm induction early response 1 homolog (Xenopus laevis)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa
- COX11 homolog, cytochrome c oxidase assembly protein (yeast)

Buy NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene now

Add to cart