Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene
PTXBC009801
New product
Data sheet of NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009801 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFB6 |
| Origin species: | Human |
| Product name: | NDUFB6-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Gene |
| Size: | 2ug |
| Accessions: | BC009801 |
| Gene id: | 4712 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa |
| Synonyms: | B17; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 6; CI-B17; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa; NADH-ubiquinone oxidoreductase B17 subunit; NADH-ubiquinone oxidoreductase beta subunit, 6; complex I, mitochondrial respiratory chain, B17 subunit; complex I-B17; NADH:ubiquinone oxidoreductase subunit B6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggggtacactccggatgagaaactgcggctgcagcagctgcgagagctgagaaggcgatggctgaaggaccaggagctgagccctcgggagccggtgctgcccccacagaagatggggcctatggagaaattctggaataaatttttggagaataaatccccttggaggaaaatggtccatggggtatacaaaaagagtatctttgttttcactcatgtacttgtacctgtctggattattcattattacatgaagtatcatgtttctgaaaaaccatatggcatagttgaaaagaagtccagaatattccctggtgatacaattctggagactggagaagtaattccaccaatgaaagaatttcctgatcaacatcattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) - mesoderm induction early response 1 homolog (Xenopus laevis) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa - COX11 homolog, cytochrome c oxidase assembly protein (yeast) |