C1QTNF3-C1q and tumor necrosis factor related protein 3 Gene View larger

C1QTNF3-C1q and tumor necrosis factor related protein 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1QTNF3-C1q and tumor necrosis factor related protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1QTNF3-C1q and tumor necrosis factor related protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016021
Product type: DNA & cDNA
Ncbi symbol: C1QTNF3
Origin species: Human
Product name: C1QTNF3-C1q and tumor necrosis factor related protein 3 Gene
Size: 2ug
Accessions: BC016021
Gene id: 114899
Gene description: C1q and tumor necrosis factor related protein 3
Synonyms: C1ATNF3; CORCS; CORS; CORS-26; CTRP3; complement C1q tumor necrosis factor-related protein 3; cartonectin; collagenous repeat-containing sequence 26 kDa protein; collagenous repeat-containing sequence of 26-kDa; secretory protein CORS26; C1q and tumor necrosis factor related protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttctctggcaacccacttcagcaatcagaacagtgggattatcttcagcagtgttgagaccaacattggaaacttctttgatgtcatgactggtagatttggggccccagtatcaggtgtgtatttcttcaccttcagcatgatgaagcatgaggatgttgaggaagtgtatgtgtaccttatgcacaatggcaacacagtcttcagcatgtacagctatgaaatgaagggcaaatcagatacatccagcaatcatgctgtgctgaagctagccgaaggggatgaggtttggctgcgaatgggcaatggcgctctccatggggaccaccaacgcttctccacctttgcaggattcctgctctttgaaactaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PEST proteolytic signal containing nuclear protein
- small nuclear ribonucleoprotein 25kDa (U11/U12)
- polymerase (RNA) II (DNA directed) polypeptide D
- FUS interacting protein (serine/arginine-rich) 1

Buy C1QTNF3-C1q and tumor necrosis factor related protein 3 Gene now

Add to cart