AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene View larger

AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021245
Product type: DNA & cDNA
Ncbi symbol: AFG3L1
Origin species: Human
Product name: AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC021245
Gene id: 172
Gene description: AFG3 ATPase family gene 3-like 1 (S. cerevisiae)
Synonyms: 1700047G05Rik; 3110061K15Rik; AFG3-like protein 1; AFG3(ATPase family gene 3)-like 1; AFG3-like AAA ATPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatttgtgaatttcctgaagaatcccaagcagtatcaggacttaggagcaaaaattccaaagggagccatgctcactggtcctcctggtaccggcaagacccttcttgccaaagcaactgcaggggaggccactgtgcccttcatcactgtgaacgggtctgagttcctggaaatgtttattggcgttgggccagcaaggggttcaactctgccaccaacgtcgtggtgttggctggcaccaaccgccctgacgtcctggacccggccctcatgcggcctggccggtttcatcgccagatttacactggtcccccttacattaaaggcaggtcctccatctttaaggtccacctgcgcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C1q and tumor necrosis factor related protein 3
- PEST proteolytic signal containing nuclear protein
- small nuclear ribonucleoprotein 25kDa (U11/U12)
- polymerase (RNA) II (DNA directed) polypeptide D

Buy AFG3L1-AFG3 ATPase family gene 3-like 1 (S. cerevisiae) Gene now

Add to cart