Login to display prices
Login to display prices
ZNF587-zinc finger protein 587 Gene View larger

ZNF587-zinc finger protein 587 Gene

PTXBC017219

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF587-zinc finger protein 587 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF587-zinc finger protein 587 Gene

Proteogenix catalog: PTXBC017219
Ncbi symbol: ZNF587
Product name: ZNF587-zinc finger protein 587 Gene
Size: 2ug
Accessions: BC017219
Gene id: 84914
Gene description: zinc finger protein 587
Synonyms: ZF6; zinc finger protein 587; zinc finger protein zfp6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtttcttctcagcaaggtgagattatggaatccagaatcttttttcaggggtcacatgcccatttccccacttgcatgaatgtcgacactgcagccacagttttggccgtaaatgtgaatttggcaagtaaccactgttcccagggaaatgtcccaatcagaagaagattatctgggacactgatactgacagggagatgggacattctgagggacccggaggcagggtgccacctcctcaacttccctgagggctgcctagaatctgtttcctctcactctgaattattcttcctcttatggctgaccaaaaacatggaacctcacaaagtccactgtaacagctttatatttgtgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: