ZNF576-zinc finger protein 576 Gene View larger

ZNF576-zinc finger protein 576 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF576-zinc finger protein 576 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF576-zinc finger protein 576 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002981
Product type: DNA & cDNA
Ncbi symbol: ZNF576
Origin species: Human
Product name: ZNF576-zinc finger protein 576 Gene
Size: 2ug
Accessions: BC002981
Gene id: 79177
Gene description: zinc finger protein 576
Synonyms: zinc finger protein 576
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacccgaaccctgaagagaacatgaagcagcaggattcacccaaggagagaagtccccagagcccaggaggcaacatctgccacctgggggccccgaagtgcacccgctgcctcatcaccttcgcagattccaagttccaggagcgtcacatgaagcgggagcacccagcggacttcgtggcccagaagctgcagggggtcctcttcatctgcttcacctgcgcccgctccttcctctcctccaaagccctaatcacccaccagcgcagccacggtccagccgccaagcccaccctgccggttgcaaccactactgcccagcccaccttcccttgtcctgactgtggcaagacctttgggcaggctgtttctctgaggcggcaccgccagatgcatgaggtccgtgcccctcctggcaccttcgcctgcacagagtgcggtcaggactttgctcaggaagcagggctgcatcaacactacattcggcatgcccggggggagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 183
- zinc finger protein 684
- APAF1 interacting protein
- zinc finger protein 266

Buy ZNF576-zinc finger protein 576 Gene now

Add to cart