Login to display prices
Login to display prices
ZNF576-zinc finger protein 576 Gene View larger

ZNF576-zinc finger protein 576 Gene

PTXBC002981

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF576-zinc finger protein 576 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF576-zinc finger protein 576 Gene

Proteogenix catalog: PTXBC002981
Ncbi symbol: ZNF576
Product name: ZNF576-zinc finger protein 576 Gene
Size: 2ug
Accessions: BC002981
Gene id: 79177
Gene description: zinc finger protein 576
Synonyms: zinc finger protein 576
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacccgaaccctgaagagaacatgaagcagcaggattcacccaaggagagaagtccccagagcccaggaggcaacatctgccacctgggggccccgaagtgcacccgctgcctcatcaccttcgcagattccaagttccaggagcgtcacatgaagcgggagcacccagcggacttcgtggcccagaagctgcagggggtcctcttcatctgcttcacctgcgcccgctccttcctctcctccaaagccctaatcacccaccagcgcagccacggtccagccgccaagcccaccctgccggttgcaaccactactgcccagcccaccttcccttgtcctgactgtggcaagacctttgggcaggctgtttctctgaggcggcaccgccagatgcatgaggtccgtgcccctcctggcaccttcgcctgcacagagtgcggtcaggactttgctcaggaagcagggctgcatcaacactacattcggcatgcccggggggagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: