Login to display prices
Login to display prices
APIP-APAF1 interacting protein Gene View larger

APIP-APAF1 interacting protein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APIP-APAF1 interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APIP-APAF1 interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008440
Product type: DNA & cDNA
Ncbi symbol: APIP
Origin species: Human
Product name: APIP-APAF1 interacting protein Gene
Size: 2ug
Accessions: BC008440
Gene id: 51074
Gene description: APAF1 interacting protein
Synonyms: APIP2; CGI-29; CGI29; MMRP19; hAPIP; methylthioribulose-1-phosphate dehydratase; MTRu-1-P dehydratase; APAF1 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggctgtgatgctcgggagggagactgttgttcccggagatgcggcgcgcaggacaaggagcgtccaagatacctgatcccagaactttgcaaacagttttaccatttaggctgggtcactgggactggaggaggaattagcttgaagcatggcgatgaaatctacattgctccttcaggagtgcaaaaggaacgaattcagcctgaagacatgtttgtttgtgatataaatgaaaaggacataagtggaccttcgccatcgaagaagctaaaaaaaagccagtgtactcctcttttcatgaatgcttacacaatgagaggagcaggtgcagtgattcatacccactctaaagctgctgtgatggccacacttctctttccaggacgggagtttaaaattacacatcaagagatgataaaaggaataaagaaatgtacttccggagggtattatagatatgatgatatgttagtggtacccattattgagaatacacctgaggagaaagacctcaaagatagaatggctcatgcagtgaatgaatacccagactcctgtgcagtactggtcagacgtcatggagtatatgtgtggggggaaacatgggagaaggccaaaaccatgtgtgagtgttatgactatttatttgatattgccgtatcaatgaagaaagtaggacttgatccttcacagctcccagttggagaaaatggaattgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 266
- cell cycle related kinase
- zinc finger protein 397
- ring finger protein 126