CCRK-cell cycle related kinase Gene View larger

CCRK-cell cycle related kinase Gene

PTXBC002655

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCRK-cell cycle related kinase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCRK-cell cycle related kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002655
Product type: DNA & cDNA
Ncbi symbol: CCRK
Origin species: Human
Product name: CCRK-cell cycle related kinase Gene
Size: 2ug
Accessions: BC002655
Gene id: 23552
Gene description: cell cycle related kinase
Synonyms: CCRK; CDCH; P42; PNQALRE; cyclin-dependent kinase 20; CAK-kinase p42; CDK-activating kinase p42; cell cycle-related kinase; cell division protein kinase 20; cyclin-dependent protein kinase H; cyclin-kinase-activating kinase p42; cyclin dependent kinase 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccagtactgcatcctgggccgcatcggggagggcgcccacggcatcgtcttcaaggccaagcacgtggagactggcgagatagttgccctcaagaaggtggccctaaggcggttggaagacggcttccctaaccaggccctgcgggagattaaggctctgcaggagatggaggacaatcagtatgtggtacaactgaaggctgtgttcccacacggtggaggctttgtgctggcctttgagttcatgctgtcggatctggccgaggtggtgcgccatgcccagaggccactagcccaggcacaggtcaagagctacctgcagatgctgctcaagggtgtcgccttctgccatgccaacaacattgtacatcgggacctgaaacctgccaacctgctcatcagcgcctcaggccagctcaagatagcggactttggcctggctcgagtcttttccccagacggcagccgcctctacacacaccaggtggccaccaggtctgtgggctgcatcatgggggagctgttgaatgggtccccccttttcccgggcaagaacgatattgaacagctttgctatgtgcttcgcatcttgggcaccccaaaccctcaagtctggccggagctcactgagctgccggactacaacaagatctcctttaaggagcaggtgcccatgcccctggaggaggtgctgcctgacgtctctccccaggcattggatctgctgggtcaattccttctctaccctcctcaccagcgcatcgcagcttccaagctcccctgcctgcccatccatctgagctgccgattcctcagcgtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 397
- ring finger protein 126
- Golgi-localized protein
- pericentriolar material 1

Buy CCRK-cell cycle related kinase Gene now

Add to cart