Login to display prices
Login to display prices
RNF183-ring finger protein 183 Gene View larger

RNF183-ring finger protein 183 Gene

PTXBC013036

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF183-ring finger protein 183 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF183-ring finger protein 183 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013036
Product type: DNA & cDNA
Ncbi symbol: RNF183
Origin species: Human
Product name: RNF183-ring finger protein 183 Gene
Size: 2ug
Accessions: BC013036
Gene id: 138065
Gene description: ring finger protein 183
Synonyms: RING finger protein 183
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagcagcagggccgggagcttgaggctgagtgccccgtctgctggaaccccttcaacaacacgttccatacccccaaaatgctggattgctgccactccttctgcgtggaatgtctggcccacctcagccttgtgactccagcccggcgccgcctgctgtgcccactctgtcgccagcccacagtgctggcctcagggcagcctgtcactgacttgcccacggacactgccatgctcaccctgctccgcctggagccccaccatgtcatcctggaaggccatcagctgtgcctcaaggaccagcccaagagccgctacttcctgcgccagcctcgagtctacacgctggaccttggcccccagcctgggggccagactgggccgcccccagacacggcctctgccaccgtgtctacgcccatcctcatccccagccaccactctttgagggagtgtttccgcaaccctcagttccgcatctttgcctacctgatggccgtcatcctcagtgtcactctgttgctcatattctccatcttttggaccaagcagttcctttggggtgtggggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 684
- APAF1 interacting protein
- zinc finger protein 266
- cell cycle related kinase