RNF111-ring finger protein 111 Gene View larger

RNF111-ring finger protein 111 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF111-ring finger protein 111 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNF111-ring finger protein 111 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010369
Product type: DNA & cDNA
Ncbi symbol: RNF111
Origin species: Human
Product name: RNF111-ring finger protein 111 Gene
Size: 2ug
Accessions: BC010369
Gene id: 54778
Gene description: ring finger protein 111
Synonyms: ARK; E3 ubiquitin-protein ligase Arkadia; ring finger protein 111
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttcctgatatggcaggctatcctcacatccgttacatttcatcaggattggatggaacatcattcagaggtcctttcaggggcaattttgaggaactgattcatttggaagaaagattaggcaatgtcaatcgtggagcatcccaggggacaattgaaagatgtacatatccacataaatacaaaaagaggaaactgcactgcaaacaagatggggaagaagggactgaggaagacacagaggaaaaatgtactatctgtttgtctattttagaggaaggtgaagatgtgagacgtcttccatgtatgcaccttttccaccaagtgtgtgttgaccaatggttgattaccaataagaagtgccccatatgcagagtggacattgaggcccagctgccaagtgaaagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ArfGAP with FG repeats 2
- zinc finger protein 576
- ring finger protein 183
- zinc finger protein 684

Buy RNF111-ring finger protein 111 Gene now

Add to cart