AGFG2-ArfGAP with FG repeats 2 Gene View larger

AGFG2-ArfGAP with FG repeats 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGFG2-ArfGAP with FG repeats 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AGFG2-ArfGAP with FG repeats 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009393
Product type: DNA & cDNA
Ncbi symbol: AGFG2
Origin species: Human
Product name: AGFG2-ArfGAP with FG repeats 2 Gene
Size: 2ug
Accessions: BC009393
Gene id: 3268
Gene description: ArfGAP with FG repeats 2
Synonyms: HRBL; RABR; arf-GAP domain and FG repeat-containing protein 2; HIV-1 Rev-binding protein-like protein; Rev/Rex activation domain binding protein-related; arf-GAP domain and FG repeats-containing protein 2; nucleoporin; rev/Rex activation domain-binding protein related; ArfGAP with FG repeats 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgatggcggcgaagaagggcccgggcccgggcggcggggtcagcgggggcaaggcggaggcggaggcggcctcggaggtgtggtgccgtcgggtgcgggagctgggtggctgcagccaggccgggaaccgccactgcttcgagtgcgcccagcgcggggtcacctacgtggatatcaccgtgggcagcttcgtgtgcaccacctgctccggcctcctgagagggctgaacccccctcatcgtgtcaagtcaatctccatgacaactttcactgagcctgaagtagtattcctgcaatcccgtggaaatgaggtttgccggaagatttggttgggtctgtttgatgctcggacatctttagtaccagattccagggatcctcagaaagtgaaggagtttctccaggaaaaatatgagaagaagagatggccagacaccttcccaaggaggctttgccaactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 576
- ring finger protein 183
- zinc finger protein 684
- APAF1 interacting protein

Buy AGFG2-ArfGAP with FG repeats 2 Gene now

Add to cart