EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene View larger

EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004459
Product type: DNA & cDNA
Ncbi symbol: EIF4EBP1
Origin species: Human
Product name: EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene
Size: 2ug
Accessions: BC004459
Gene id: 1978
Gene description: eukaryotic translation initiation factor 4E binding protein 1
Synonyms: 4EBP1; BP-1; PHAS-I; eukaryotic translation initiation factor 4E-binding protein 1; eIF4E-binding protein 1; phosphorylated heat- and acid-stable protein regulated by insulin 1; eukaryotic translation initiation factor 4E binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgggggcagcagctgcagccagaccccaagccgggccatccccgccactcgccgggtggtgctcggcgacggcgtgcagctcccgcccggggactacagcacgacccccggcggcacgctcttcagcaccaccccgggaggtaccaggatcatctatgaccggaaattcctgatggagtgtcggaactcacctgtgaccaaaacacccccaagggatctgcccaccattccgggggtcaccagcccttccagtgatgagccccccatggaagccagccagagccacctgcgcaatagcccagaagataagcgggcgggcggtgaagagtcacagtttgagatggacatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 2 receptor, gamma (severe combined immunodeficiency)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
- resistance to inhibitors of cholinesterase 3 homolog (C. elegans)
- signal transducing adaptor molecule (SH3 domain and ITAM motif) 1

Buy EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene now

Add to cart