Login to display prices
Login to display prices
EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene View larger

EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene

PTXBC004459

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene

Proteogenix catalog: PTXBC004459
Ncbi symbol: EIF4EBP1
Product name: EIF4EBP1-eukaryotic translation initiation factor 4E binding protein 1 Gene
Size: 2ug
Accessions: BC004459
Gene id: 1978
Gene description: eukaryotic translation initiation factor 4E binding protein 1
Synonyms: 4EBP1; BP-1; PHAS-I; eukaryotic translation initiation factor 4E-binding protein 1; eIF4E-binding protein 1; phosphorylated heat- and acid-stable protein regulated by insulin 1; eukaryotic translation initiation factor 4E binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgggggcagcagctgcagccagaccccaagccgggccatccccgccactcgccgggtggtgctcggcgacggcgtgcagctcccgcccggggactacagcacgacccccggcggcacgctcttcagcaccaccccgggaggtaccaggatcatctatgaccggaaattcctgatggagtgtcggaactcacctgtgaccaaaacacccccaagggatctgcccaccattccgggggtcaccagcccttccagtgatgagccccccatggaagccagccagagccacctgcgcaatagcccagaagataagcgggcgggcggtgaagagtcacagtttgagatggacatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: