IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene View larger

IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014972
Product type: DNA & cDNA
Ncbi symbol: IL2RG
Origin species: Human
Product name: IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene
Size: 2ug
Accessions: BC014972
Gene id: 3561
Gene description: interleukin 2 receptor, gamma (severe combined immunodeficiency)
Synonyms: CD132; CIDX; IL-2RG; IMD4; P64; SCIDX; SCIDX1; cytokine receptor common subunit gamma; CD132 antigen; IL-2 receptor subunit gamma; IL-2R subunit gamma; common cytokine receptor gamma chain; gammaC; interleukin 2 receptor, gamma; interleukin 2 receptor subunit gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgaagccatcattaccattcacatccctcttattcctgcagctgcccctgctgggagtggggctgaacacgacaattctgacgcccaatgggaatgaagacaccacagctgatttcttcctgaccactatgcccactgactccctcagtgtttccactctgcccctcccagaggttcagtgttttgtgttcaatgtcgagtacatgaattgcacttggaacagcagctctgagccccagcctaccaacctcactctgcattattggtacaagaactcggataatgataaagtccagaagtgcagccactatctattctctgaagaaatcacttctggctgtcagttgcaaaaaaaggagatccacctctaccaaacatttgttgttcagctccaggacccacgggaacccaggagacaggccacacagatgctaaaactgcagaatctggtgatcccctgggctccagagaacctaacacttcacaaactgagtgaatcccagctagaactgaactggaacaacagattcttgaaccactgtttggagcacttggtgcagtaccggactgactgggaccacagctggactgaacaatcagtggattatagacataagttctccttgcctagtgtggatgggcagaaacgctacacgtttcgtgttcggagccgctttaacccactctgtggaagtgctcagcattggagtgaatggagccacccaatccactgggggagcaatacttcaaaagagaatcctttcctgtttgcattggaagccgtggttatctctgttggctccatgggattgattatcagccttctctgtgtgtatttctggctggaacggacgatgccccgaattcccaccctgaagaacctagaggatcttgttactgaataccacgggaacttttcggcctggagtggtgtgtctaagggactggctgagagtctgcagccagactacagtgaacgactctgcctcgtcagtgagattcccccaaaaggaggggcccttggggaggggcctggggcctccccatgcaaccagcatagcccctactgggcccccccatgttacaccctaaagcctgaaacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
- resistance to inhibitors of cholinesterase 3 homolog (C. elegans)
- signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
- leucine rich repeat and fibronectin type III domain containing 4

Buy IL2RG-interleukin 2 receptor, gamma (severe combined immunodeficiency) Gene now

Add to cart