NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene View larger

NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene

PTXBC010665

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010665
Product type: DNA & cDNA
Ncbi symbol: NDUFB11
Origin species: Human
Product name: NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene
Size: 2ug
Accessions: BC010665
Gene id: 54539
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Synonyms: CI-ESSS; ESSS; NP17.3; Np15; P17.3; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, mitochondrial; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa; NADH-ubiquinone oxidoreductase ESSS subunit; complex I NP17.3 subunit; complex I-ESSS; neuronal protein 17.3; NADH:ubiquinone oxidoreductase subunit B11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgggctgtttggtttgagcgctcgccgtcttttggcggcagcggcgacgcgagggctcccggccgcccgcgtccgctgggaatctagcttctccaggactgtggtcgccccgtccgctgtggcgggaaagcggcccccagaaccgaccacaccgtggcaagaggacccagaacccgaggacgaaaacttgtatgagaagaacccagactcccatggttatgacaaggaccccgttttggacgtctggaacatgcgacttgtcttcttctttggcgtctccatcatcctggtccttggcagcacctttgtggcctatctgcctgactacaggatgaaagagtggtcccgccgcgaagctgagaggcttgtgaaataccgagaggccaatggccttcccatcatggaatccaactgcttcgaccccagcaagatccagctgccagaggatgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - resistance to inhibitors of cholinesterase 3 homolog (C. elegans)
- signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
- leucine rich repeat and fibronectin type III domain containing 4
- eukaryotic translation initiation factor 4E binding protein 2

Buy NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene now

Add to cart