Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene
PTXBC010665
New product
Data sheet of NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010665 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFB11 |
| Origin species: | Human |
| Product name: | NDUFB11-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Gene |
| Size: | 2ug |
| Accessions: | BC010665 |
| Gene id: | 54539 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa |
| Synonyms: | CI-ESSS; ESSS; NP17.3; Np15; P17.3; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, mitochondrial; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa; NADH-ubiquinone oxidoreductase ESSS subunit; complex I NP17.3 subunit; complex I-ESSS; neuronal protein 17.3; NADH:ubiquinone oxidoreductase subunit B11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctgggctgtttggtttgagcgctcgccgtcttttggcggcagcggcgacgcgagggctcccggccgcccgcgtccgctgggaatctagcttctccaggactgtggtcgccccgtccgctgtggcgggaaagcggcccccagaaccgaccacaccgtggcaagaggacccagaacccgaggacgaaaacttgtatgagaagaacccagactcccatggttatgacaaggaccccgttttggacgtctggaacatgcgacttgtcttcttctttggcgtctccatcatcctggtccttggcagcacctttgtggcctatctgcctgactacaggatgaaagagtggtcccgccgcgaagctgagaggcttgtgaaataccgagaggccaatggccttcccatcatggaatccaactgcttcgaccccagcaagatccagctgccagaggatgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - resistance to inhibitors of cholinesterase 3 homolog (C. elegans) - signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 - leucine rich repeat and fibronectin type III domain containing 4 - eukaryotic translation initiation factor 4E binding protein 2 |